Incidental Mutation 'R1465:Tax1bp1'
ID201057
Institutional Source Beutler Lab
Gene Symbol Tax1bp1
Ensembl Gene ENSMUSG00000004535
Gene NameTax1 (human T cell leukemia virus type I) binding protein 1
Synonyms1700069J21Rik, 1200003J11Rik, D6Ertd404e, D6Ertd772e, T6BP, TXBP151
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location52713729-52766780 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 52727194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080723] [ENSMUST00000129660] [ENSMUST00000138040] [ENSMUST00000149588]
Predicted Effect probably benign
Transcript: ENSMUST00000080723
SMART Domains Protein: ENSMUSP00000079548
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 15 416 2.6e-92 PFAM
coiled coil region 569 620 N/A INTRINSIC
ZnF_C2H2 753 778 7.57e1 SMART
ZnF_C2H2 780 805 3.21e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128173
Predicted Effect probably benign
Transcript: ENSMUST00000129660
SMART Domains Protein: ENSMUSP00000122922
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 87 3.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138040
SMART Domains Protein: ENSMUSP00000119522
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 172 8.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149588
SMART Domains Protein: ENSMUSP00000116059
Gene: ENSMUSG00000004535

DomainStartEndE-ValueType
Pfam:CALCOCO1 11 161 2.3e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203787
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 93.6%
  • 20x: 86.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HTLV-1 tax1 binding protein. The encoded protein interacts with TNFAIP3, and inhibits TNF-induced apoptosis by mediating the TNFAIP3 anti-apoptotic activity. Degradation of this protein by caspase-3-like family proteins is associated with apoptosis induced by TNF. This protein may also have a role in the inhibition of inflammatory signaling pathways. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Knockout mice are born alive but fail to thrive and develop inflammatory cardiac valvulitis and dermatitis, die prematurely, and are hypersensitive to low doses of TNF and IL-1beta. In contrast, embryos homozygous for a gene trap mutation die at E13.5 from hemorrhaging and/or cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dhfr A G 13: 92,368,307 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mtor G T 4: 148,525,993 probably benign Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nagpa G T 16: 5,201,528 probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Ntrk3 T C 7: 78,356,014 probably benign Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Plekhg4 T C 8: 105,381,040 probably benign Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rnf123 T C 9: 108,071,466 probably benign Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sh3bp1 T C 15: 78,907,345 probably benign Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Skor2 A T 18: 76,876,645 probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Speg A G 1: 75,428,484 probably benign Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Tcof1 A G 18: 60,818,954 probably benign Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Tax1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Tax1bp1 APN 6 52753366 missense probably benign 0.16
IGL03177:Tax1bp1 APN 6 52736947 missense possibly damaging 0.95
R0836:Tax1bp1 UTSW 6 52741940 splice site probably benign
R1119:Tax1bp1 UTSW 6 52741948 splice site probably benign
R1456:Tax1bp1 UTSW 6 52744244 missense probably benign 0.01
R1484:Tax1bp1 UTSW 6 52733320 missense probably damaging 0.99
R1661:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1665:Tax1bp1 UTSW 6 52736912 missense probably benign 0.18
R1712:Tax1bp1 UTSW 6 52729326 missense probably damaging 1.00
R1752:Tax1bp1 UTSW 6 52721413 missense probably damaging 1.00
R1913:Tax1bp1 UTSW 6 52765952 missense probably damaging 1.00
R2496:Tax1bp1 UTSW 6 52758357 critical splice donor site probably null
R3782:Tax1bp1 UTSW 6 52739548 missense probably damaging 1.00
R3804:Tax1bp1 UTSW 6 52742785 missense probably benign 0.45
R4238:Tax1bp1 UTSW 6 52766051 nonsense probably null
R4303:Tax1bp1 UTSW 6 52727278 missense possibly damaging 0.90
R4665:Tax1bp1 UTSW 6 52737131 missense probably benign 0.00
R4870:Tax1bp1 UTSW 6 52729493 intron probably benign
R5009:Tax1bp1 UTSW 6 52729493 intron probably benign
R5965:Tax1bp1 UTSW 6 52729332 missense probably damaging 1.00
R6313:Tax1bp1 UTSW 6 52744356 critical splice donor site probably null
R6328:Tax1bp1 UTSW 6 52746709 missense probably benign 0.03
R6338:Tax1bp1 UTSW 6 52729376 nonsense probably null
R6886:Tax1bp1 UTSW 6 52733223 missense probably benign 0.43
R7251:Tax1bp1 UTSW 6 52721356 missense possibly damaging 0.95
R7531:Tax1bp1 UTSW 6 52746697 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- tgacctttggcctcTCATAATCTTGAATCT -3'
(R):5'- GCTATGAAAACCCCTTGTGCCCT -3'

Sequencing Primer
(F):5'- gaggttcagtccattatcatcaag -3'
(R):5'- CACATGGCATTTACAGTCATCTG -3'
Posted On2014-05-23