Incidental Mutation 'R1465:Vmn2r51'
ID 201058
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 039519-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1465 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9834249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 263 (I263T)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: I263T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: I263T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 93.6%
  • 20x: 86.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,651,866 (GRCm39) Y121H probably damaging Het
Abca13 G T 11: 9,349,303 (GRCm39) G3626W probably damaging Het
Acvr1c A G 2: 58,174,973 (GRCm39) Y192H probably damaging Het
Afm A T 5: 90,698,200 (GRCm39) D534V probably damaging Het
Agl T C 3: 116,565,021 (GRCm39) E1076G probably benign Het
Ahcyl T C 16: 45,974,211 (GRCm39) K389E probably benign Het
Angptl3 A T 4: 98,925,757 (GRCm39) H361L probably benign Het
Apob T C 12: 8,061,421 (GRCm39) F3301S possibly damaging Het
Arhgef33 T A 17: 80,674,730 (GRCm39) C376S possibly damaging Het
Ass1 A G 2: 31,410,428 (GRCm39) *413W probably null Het
Atp6v1h T A 1: 5,165,911 (GRCm39) L127Q probably damaging Het
Bcl2l1 G A 2: 152,671,870 (GRCm39) S14F probably damaging Het
Bhmt1b T G 18: 87,775,382 (GRCm39) F302V probably damaging Het
Birc6 G A 17: 74,930,853 (GRCm39) A2477T probably benign Het
Bpifb9a G A 2: 154,112,941 (GRCm39) A589T possibly damaging Het
Casp9 C A 4: 141,533,151 (GRCm39) T252K probably benign Het
Cct4 G A 11: 22,952,922 (GRCm39) D533N probably damaging Het
Clcn6 A C 4: 148,098,358 (GRCm39) I555S probably damaging Het
Col4a4 A T 1: 82,475,543 (GRCm39) probably null Het
Cyp2d10 A T 15: 82,288,129 (GRCm39) probably null Het
D930048N14Rik A G 11: 51,545,740 (GRCm39) probably benign Het
Dhfr A G 13: 92,504,815 (GRCm39) probably benign Het
Dlg5 T C 14: 24,204,764 (GRCm39) probably null Het
Dnah11 T C 12: 118,002,430 (GRCm39) E2240G probably damaging Het
Dnmt3a A G 12: 3,916,088 (GRCm39) E17G probably damaging Het
Dock1 A G 7: 134,384,138 (GRCm39) T670A probably benign Het
Dpy19l2 A G 9: 24,580,618 (GRCm39) M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 (GRCm39) S212P probably damaging Het
Ephb6 T C 6: 41,593,040 (GRCm39) F426S probably damaging Het
F5 A T 1: 164,026,402 (GRCm39) D1658V probably benign Het
Faah A T 4: 115,856,755 (GRCm39) V469E probably damaging Het
Fas T C 19: 34,294,013 (GRCm39) C123R probably damaging Het
Fhod1 T C 8: 106,065,546 (GRCm39) probably benign Het
Filip1 A G 9: 79,805,589 (GRCm39) V55A probably benign Het
Frmpd1 G A 4: 45,273,197 (GRCm39) R372Q probably damaging Het
Glyctk C T 9: 106,034,806 (GRCm39) G87S probably damaging Het
Golga3 T C 5: 110,357,744 (GRCm39) L1080P probably damaging Het
Gpr137 T C 19: 6,915,812 (GRCm39) T281A probably benign Het
Grap2 T A 15: 80,532,612 (GRCm39) probably null Het
Hlcs T C 16: 94,069,151 (GRCm39) D170G probably damaging Het
Hook1 A G 4: 95,901,493 (GRCm39) T484A probably benign Het
Hoxa5 T A 6: 52,180,771 (GRCm39) H187L probably benign Het
Inpp1 G T 1: 52,829,253 (GRCm39) S255R probably benign Het
Inpp4b T A 8: 82,494,786 (GRCm39) V67E probably damaging Het
Iqgap3 A G 3: 87,994,616 (GRCm39) N105S probably damaging Het
Kcnq5 A G 1: 21,539,692 (GRCm39) probably null Het
Klhl1 T C 14: 96,477,649 (GRCm39) N473S probably benign Het
Klk1b24 C A 7: 43,840,785 (GRCm39) T71N probably benign Het
Loxhd1 A G 18: 77,468,269 (GRCm39) probably null Het
Lrp1b C T 2: 41,001,071 (GRCm39) R2165Q probably benign Het
Lrp2bp A T 8: 46,478,272 (GRCm39) Q328L possibly damaging Het
Lrrc63 T A 14: 75,344,829 (GRCm39) K419N possibly damaging Het
Lrrc9 A G 12: 72,547,533 (GRCm39) N150S probably benign Het
Lrrn4 C A 2: 132,713,995 (GRCm39) C317F probably damaging Het
Ltbp2 T C 12: 84,860,074 (GRCm39) S627G probably damaging Het
Macf1 A T 4: 123,386,947 (GRCm39) S1224T probably damaging Het
Meis2 A C 2: 115,889,151 (GRCm39) H200Q probably benign Het
Mesd C A 7: 83,544,790 (GRCm39) A80E probably benign Het
Mtor G T 4: 148,610,450 (GRCm39) probably benign Het
Myo3a T C 2: 22,467,939 (GRCm39) F398L probably benign Het
Nagpa G T 16: 5,019,392 (GRCm39) probably benign Het
Nanp A G 2: 150,872,749 (GRCm39) C60R probably benign Het
Nectin2 T G 7: 19,464,041 (GRCm39) M313L probably benign Het
Nek4 C T 14: 30,678,844 (GRCm39) H123Y probably damaging Het
Nploc4 A G 11: 120,299,607 (GRCm39) V371A probably damaging Het
Ntrk3 T C 7: 78,005,762 (GRCm39) probably benign Het
Or11g7 A G 14: 50,690,634 (GRCm39) T42A possibly damaging Het
Or13c7b A G 4: 43,820,723 (GRCm39) F213L probably benign Het
Or52n4 T C 7: 104,294,153 (GRCm39) N140S probably benign Het
Or5b109 T A 19: 13,212,265 (GRCm39) V217E possibly damaging Het
Pcdh20 T A 14: 88,706,673 (GRCm39) Q209L probably benign Het
Pcdhb20 G A 18: 37,637,750 (GRCm39) R92H probably damaging Het
Pgap1 T C 1: 54,567,714 (GRCm39) H377R probably benign Het
Phyhipl G T 10: 70,406,798 (GRCm39) P52Q probably damaging Het
Plekhg4 T C 8: 106,107,672 (GRCm39) probably benign Het
Pwwp2a T A 11: 43,596,383 (GRCm39) V516E possibly damaging Het
Rack1 T C 11: 48,692,586 (GRCm39) V69A probably damaging Het
Rexo5 T A 7: 119,400,581 (GRCm39) probably null Het
Rnf123 T C 9: 107,948,665 (GRCm39) probably benign Het
Rock1 G T 18: 10,072,863 (GRCm39) Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,560,266 (GRCm39) L568P probably damaging Het
Seh1l T C 18: 67,917,054 (GRCm39) S78P probably damaging Het
Serpinb3b A T 1: 107,083,573 (GRCm39) probably null Het
Setd1a T C 7: 127,387,512 (GRCm39) probably benign Het
Setx G T 2: 29,030,401 (GRCm39) probably null Het
Sh3bp1 T C 15: 78,791,545 (GRCm39) probably benign Het
Shc2 G T 10: 79,467,136 (GRCm39) R146S probably damaging Het
Skap2 T C 6: 51,886,348 (GRCm39) T5A probably benign Het
Skor2 A T 18: 76,964,340 (GRCm39) probably benign Het
Slc35a3 T C 3: 116,480,983 (GRCm39) I93M probably benign Het
Sohlh1 C T 2: 25,733,359 (GRCm39) G295D probably damaging Het
Speg A G 1: 75,405,128 (GRCm39) probably benign Het
Sult2a8 A C 7: 14,150,208 (GRCm39) C168G probably benign Het
Tax1bp1 T C 6: 52,704,179 (GRCm39) probably benign Het
Tbc1d4 T C 14: 101,685,124 (GRCm39) I1176V possibly damaging Het
Tcof1 A G 18: 60,952,026 (GRCm39) probably benign Het
Thada A T 17: 84,744,104 (GRCm39) F735I possibly damaging Het
Tle1 A C 4: 72,058,068 (GRCm39) H52Q probably damaging Het
Tmem101 A T 11: 102,044,155 (GRCm39) V244E probably damaging Het
Tnfrsf26 C A 7: 143,171,668 (GRCm39) C95F probably damaging Het
Uspl1 T C 5: 149,150,842 (GRCm39) S482P probably benign Het
Vmn2r118 G T 17: 55,917,935 (GRCm39) N192K probably benign Het
Vmn2r14 C T 5: 109,368,195 (GRCm39) V266I possibly damaging Het
Zfp937 T A 2: 150,080,967 (GRCm39) C332* probably null Het
Zscan21 T A 5: 138,123,470 (GRCm39) S50T probably benign Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGCCTGTTGCAGATTCATCTCG -3'
(R):5'- TGGAACTGGATTGGCCTTGTCATTC -3'

Sequencing Primer
(F):5'- GACTACTCTCACTAAAGGTCATGTC -3'
(R):5'- TGTCATTCCAGATGACGATCAAGG -3'
Posted On 2014-05-23