Incidental Mutation 'R0090:Itih5'
ID 20108
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 038377-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0090 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 10169495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 31 (V31I)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: V31I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: V31I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
4933427I04Rik A G 4: 123,754,775 (GRCm39) T230A possibly damaging Het
Acsm1 T C 7: 119,261,412 (GRCm39) probably benign Het
Acta1 T C 8: 124,620,396 (GRCm39) N14S probably damaging Het
Aff4 A G 11: 53,283,609 (GRCm39) T362A probably benign Het
Aggf1 A G 13: 95,501,467 (GRCm39) I305T probably benign Het
Ap4b1 A G 3: 103,727,745 (GRCm39) D325G possibly damaging Het
Ap4e1 C T 2: 126,906,905 (GRCm39) T1055I possibly damaging Het
Arhgef2 A T 3: 88,546,655 (GRCm39) Q496L probably damaging Het
Arhgef28 A G 13: 98,211,618 (GRCm39) F122L probably damaging Het
Baiap3 G A 17: 25,469,044 (GRCm39) probably benign Het
Casp8ap2 T A 4: 32,640,327 (GRCm39) H460Q probably damaging Het
Casz1 A G 4: 149,017,868 (GRCm39) T386A probably benign Het
Cd53 A T 3: 106,674,725 (GRCm39) V114E possibly damaging Het
Celsr2 A G 3: 108,300,643 (GRCm39) probably benign Het
Cfap300 T A 9: 8,027,184 (GRCm39) N118I probably benign Het
Chaf1b G T 16: 93,684,012 (GRCm39) A88S possibly damaging Het
Cldn10 A T 14: 119,111,612 (GRCm39) Y194F probably damaging Het
Clec2e A C 6: 129,072,181 (GRCm39) probably null Het
Cmpk2 A T 12: 26,528,021 (GRCm39) T413S probably benign Het
Col9a1 T A 1: 24,262,643 (GRCm39) probably null Het
Dchs1 G T 7: 105,405,139 (GRCm39) Q2468K probably benign Het
Ddx60 A G 8: 62,395,327 (GRCm39) D88G probably damaging Het
Dnah8 A G 17: 31,003,064 (GRCm39) R3588G probably benign Het
Ect2 T C 3: 27,169,625 (GRCm39) T774A probably benign Het
Ect2 C T 3: 27,192,651 (GRCm39) E431K probably null Het
Ern1 A G 11: 106,296,649 (GRCm39) V767A probably damaging Het
Fbln1 A C 15: 85,108,489 (GRCm39) E75A possibly damaging Het
Fgf5 C T 5: 98,409,846 (GRCm39) R132* probably null Het
Folh1 T C 7: 86,375,076 (GRCm39) probably benign Het
Gdf15 A T 8: 71,082,334 (GRCm39) H257Q probably damaging Het
Ghitm T C 14: 36,844,176 (GRCm39) T322A probably benign Het
Gm5709 A G 3: 59,526,192 (GRCm39) noncoding transcript Het
Hbb-y C T 7: 103,501,950 (GRCm39) probably null Het
Hmcn2 A T 2: 31,316,210 (GRCm39) D3771V probably damaging Het
Hspa12a T C 19: 58,787,941 (GRCm39) D627G probably benign Het
Idh2 T C 7: 79,747,662 (GRCm39) E286G probably damaging Het
Idh3b C A 2: 130,122,899 (GRCm39) A297S probably benign Het
Igsf3 A G 3: 101,342,968 (GRCm39) E535G probably damaging Het
Ilf3 T A 9: 21,306,710 (GRCm39) D314E probably damaging Het
Itgb8 A G 12: 119,166,298 (GRCm39) S78P probably benign Het
Kcnj2 T C 11: 110,963,853 (GRCm39) V415A probably benign Het
Kin A G 2: 10,090,584 (GRCm39) Q53R possibly damaging Het
Krt78 A T 15: 101,856,272 (GRCm39) M513K probably benign Het
Krtap4-8 A T 11: 99,671,312 (GRCm39) probably benign Het
Ltbr T C 6: 125,286,412 (GRCm39) probably benign Het
Mgat4a G A 1: 37,529,414 (GRCm39) T146I probably damaging Het
Mrps2 G C 2: 28,358,268 (GRCm39) W19C probably damaging Het
Mthfs T C 9: 89,093,344 (GRCm39) S33P probably damaging Het
Myh6 T C 14: 55,196,161 (GRCm39) D546G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Ndst2 T C 14: 20,777,335 (GRCm39) T553A probably damaging Het
Nlrp12 T C 7: 3,288,664 (GRCm39) E616G probably damaging Het
Nrde2 T C 12: 100,095,545 (GRCm39) probably benign Het
Nup210l G A 3: 90,119,086 (GRCm39) V1832I probably benign Het
Or1e1c G A 11: 73,266,402 (GRCm39) V276I probably benign Het
Or4k77 A T 2: 111,199,639 (GRCm39) I221F probably damaging Het
Pcm1 A T 8: 41,709,078 (GRCm39) E9D probably damaging Het
Pear1 A T 3: 87,661,649 (GRCm39) D541E possibly damaging Het
Peg10 A G 6: 4,756,063 (GRCm39) probably benign Het
Prss1 G A 6: 41,438,166 (GRCm39) R31Q probably benign Het
Ptpn13 T C 5: 103,717,369 (GRCm39) V1837A probably damaging Het
Rasgrp3 A G 17: 75,805,456 (GRCm39) D149G probably damaging Het
Reg3d A T 6: 78,355,466 (GRCm39) H8Q possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Sacs T A 14: 61,442,889 (GRCm39) L1645H probably damaging Het
Slc16a5 A T 11: 115,355,751 (GRCm39) S71C probably damaging Het
Slc9a3 A G 13: 74,306,847 (GRCm39) E324G probably damaging Het
Smgc T C 15: 91,743,960 (GRCm39) V574A possibly damaging Het
Stac3 C T 10: 127,339,799 (GRCm39) probably benign Het
Supv3l1 A G 10: 62,265,485 (GRCm39) L685P probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tas2r125 G T 6: 132,887,361 (GRCm39) A250S probably benign Het
Tdrd6 C T 17: 43,939,132 (GRCm39) V639I probably benign Het
Thap12 T G 7: 98,365,100 (GRCm39) W423G probably damaging Het
Tmem245 T C 4: 56,899,410 (GRCm39) I217V probably benign Het
Trip12 T A 1: 84,709,857 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,317 (GRCm39) V102A probably benign Het
Ubap1 T C 4: 41,379,826 (GRCm39) S347P probably damaging Het
Usp10 C T 8: 120,679,935 (GRCm39) Q612* probably null Het
Vmn2r72 T C 7: 85,404,084 (GRCm39) I36V probably benign Het
Vps37a T C 8: 40,980,030 (GRCm39) I63T possibly damaging Het
Whrn C A 4: 63,350,969 (GRCm39) R9L possibly damaging Het
Xrcc1 T C 7: 24,269,642 (GRCm39) Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,075,814 (GRCm39) probably benign Het
Zfhx3 G A 8: 109,676,689 (GRCm39) D2580N possibly damaging Het
Zfhx4 A G 3: 5,308,685 (GRCm39) N637S probably damaging Het
Zfp268 A T 4: 145,349,195 (GRCm39) K211* probably null Het
Zyg11a A T 4: 108,058,544 (GRCm39) probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTCAGCAAAACAGACTGATGG -3'
(R):5'- GCTTCAATCTGCAAACGCTCTTCAC -3'

Sequencing Primer
(F):5'- GAAAAAAAAAAGTCACGGCTTTGC -3'
(R):5'- tcctcagaaccccaccc -3'
Posted On 2013-04-11