Incidental Mutation 'R1466:Kif1a'
ID 201120
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Name kinesin family member 1A
Synonyms LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock # R1466 (G1)
Quality Score 195
Status Not validated
Chromosome 1
Chromosomal Location 93015464-93101951 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93054929 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 718 (W718R)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000086819
AA Change: W718R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: W718R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112958
AA Change: W709R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171556
AA Change: W709R

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171796
AA Change: W709R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: W709R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect possibly damaging
Transcript: ENSMUST00000190723
AA Change: W718R

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: W718R

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110012J17Rik T A 17: 66,380,435 D492V probably damaging Het
Abca13 T C 11: 9,570,536 probably benign Het
Abcg8 G C 17: 84,686,727 probably benign Het
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
AC167973.1 A T 9: 43,265,352 noncoding transcript Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Capza2 T C 6: 17,657,159 probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Ccdc84 A T 9: 44,413,680 probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Clcn2 G A 16: 20,712,552 probably benign Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Col5a1 G T 2: 28,003,846 probably benign Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Csf3r T A 4: 126,031,932 probably benign Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Eda T A X: 100,392,392 probably benign Homo
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Exd1 G A 2: 119,520,734 probably benign Het
Fam184b G A 5: 45,580,509 probably benign Het
Fam20b T C 1: 156,686,188 probably benign Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Igf2r A T 17: 12,717,269 probably benign Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lrrc27 A G 7: 139,230,308 probably benign Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp1b A T 9: 7,384,779 probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Nek1 C T 8: 61,125,136 probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pald1 T C 10: 61,348,525 probably benign Het
Paox A G 7: 140,129,281 probably benign Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Homo
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Psmd2 A G 16: 20,657,965 probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rbm28 G A 6: 29,155,017 probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Homo
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Ubp1 T G 9: 113,944,835 probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wdr26 C T 1: 181,185,934 probably benign Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Zzef1 C T 11: 72,924,679 P2942S probably damaging Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
R4538_Kif1a_397 UTSW 1 93077047 missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 splice site probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
R7659:Kif1a UTSW 1 93046820 intron probably benign
R7681:Kif1a UTSW 1 93054944 missense probably benign
R7976:Kif1a UTSW 1 93039774 missense probably damaging 1.00
R8056:Kif1a UTSW 1 93054701 intron probably benign
R8420:Kif1a UTSW 1 93022419 missense probably benign
R8994:Kif1a UTSW 1 93055735 missense possibly damaging 0.77
R9016:Kif1a UTSW 1 93025673 missense probably damaging 1.00
R9206:Kif1a UTSW 1 93051480 missense probably damaging 0.99
R9246:Kif1a UTSW 1 93077779 missense probably damaging 0.98
R9252:Kif1a UTSW 1 93075054 missense probably damaging 1.00
R9388:Kif1a UTSW 1 93072307 critical splice donor site probably null
R9413:Kif1a UTSW 1 93021297 missense probably benign 0.00
R9612:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R9621:Kif1a UTSW 1 93055723 missense probably benign
R9625:Kif1a UTSW 1 93073044 missense probably benign 0.42
R9694:Kif1a UTSW 1 93022451 missense probably benign
Z1176:Kif1a UTSW 1 93021316 missense probably damaging 0.97
Z1176:Kif1a UTSW 1 93022491 missense probably damaging 1.00
Z1176:Kif1a UTSW 1 93055697 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCATTCATCCATGCCGTGAAAG -3'
(R):5'- TGGACTGAAAACAGGGCACACTC -3'

Sequencing Primer
(F):5'- ccccccGCTTGTTGACTC -3'
(R):5'- CAGCTAGTCCTGTGGCATC -3'
Posted On 2014-05-23