Incidental Mutation 'R1466:Slc7a11'
ID 201146
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, xCT, 9930009M05Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1466 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 50319385-50403947 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 50335522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably null
Transcript: ENSMUST00000029297
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000194462
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,520,536 (GRCm39) probably benign Het
Abcg8 G C 17: 84,994,155 (GRCm39) probably benign Het
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
AC167973.1 A T 9: 43,176,649 (GRCm39) noncoding transcript Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Capza2 T C 6: 17,657,158 (GRCm39) probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cenatac A T 9: 44,324,977 (GRCm39) probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Clcn2 G A 16: 20,531,302 (GRCm39) probably benign Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Col5a1 G T 2: 27,893,858 (GRCm39) probably benign Het
Corin C T 5: 72,460,133 (GRCm39) probably null Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Csf3r T A 4: 125,925,725 (GRCm39) probably benign Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Ctnnbl1 C T 2: 157,641,337 (GRCm39) probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Eda T A X: 99,435,998 (GRCm39) probably benign Homo
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Exd1 G A 2: 119,351,215 (GRCm39) probably benign Het
Fam184b G A 5: 45,737,851 (GRCm39) probably benign Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Igf2r A T 17: 12,936,156 (GRCm39) probably benign Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lrrc27 A G 7: 138,810,224 (GRCm39) probably benign Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mgat4a A T 1: 37,503,487 (GRCm39) probably benign Het
Mmp1b A T 9: 7,384,779 (GRCm39) probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nek1 C T 8: 61,578,170 (GRCm39) probably benign Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pald1 T C 10: 61,184,304 (GRCm39) probably benign Het
Paox A G 7: 139,709,194 (GRCm39) probably benign Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Homo
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Psmd2 A G 16: 20,476,715 (GRCm39) probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rbm28 G A 6: 29,155,016 (GRCm39) probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Homo
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Ubp1 T G 9: 113,773,903 (GRCm39) probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wdr26 C T 1: 181,013,499 (GRCm39) probably benign Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50,382,136 (GRCm39) missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50,333,518 (GRCm39) missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50,378,516 (GRCm39) missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50,326,788 (GRCm39) missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50,336,334 (GRCm39) missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50,338,500 (GRCm39) missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50,378,545 (GRCm39) missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50,378,500 (GRCm39) missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50,335,522 (GRCm39) splice site probably null
R1554:Slc7a11 UTSW 3 50,336,345 (GRCm39) missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50,326,795 (GRCm39) nonsense probably null
R2128:Slc7a11 UTSW 3 50,338,558 (GRCm39) missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50,332,195 (GRCm39) splice site probably null
R3116:Slc7a11 UTSW 3 50,338,588 (GRCm39) missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50,382,223 (GRCm39) missense probably benign
R4479:Slc7a11 UTSW 3 50,372,412 (GRCm39) intron probably benign
R5117:Slc7a11 UTSW 3 50,333,599 (GRCm39) missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50,397,532 (GRCm39) missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50,393,324 (GRCm39) missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50,326,780 (GRCm39) missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50,326,780 (GRCm39) missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50,333,593 (GRCm39) missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50,338,492 (GRCm39) critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50,397,680 (GRCm39) missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50,397,448 (GRCm39) missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50,378,486 (GRCm39) splice site probably null
R7756:Slc7a11 UTSW 3 50,326,809 (GRCm39) missense probably benign
R7758:Slc7a11 UTSW 3 50,326,809 (GRCm39) missense probably benign
R7821:Slc7a11 UTSW 3 50,335,476 (GRCm39) missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50,372,440 (GRCm39) missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50,378,501 (GRCm39) missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50,382,177 (GRCm39) missense probably damaging 0.98
R8318:Slc7a11 UTSW 3 50,372,435 (GRCm39) critical splice donor site probably null
R8396:Slc7a11 UTSW 3 50,338,578 (GRCm39) missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50,393,305 (GRCm39) missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50,338,564 (GRCm39) missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50,333,632 (GRCm39) missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50,332,082 (GRCm39) missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50,335,488 (GRCm39) missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50,382,201 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTCGGCCAAGGAGAGAAACCAC -3'
(R):5'- GCCCTTTGTTTCCAAAGCACAACTC -3'

Sequencing Primer
(F):5'- CTAAGGTGGGTCATATCCCAG -3'
(R):5'- TGTTTCCAAAGCACAACTCAAATG -3'
Posted On 2014-05-23