Incidental Mutation 'R1466:Corin'
ID 201165
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Name corin, serine peptidase
Synonyms Lrp4
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R1466 (G1)
Quality Score 173
Status Not validated
Chromosome 5
Chromosomal Location 72457368-72661816 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 72460133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000094710] [ENSMUST00000126664] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
AlphaFold Q9Z319
Predicted Effect probably null
Transcript: ENSMUST00000005352
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094710
SMART Domains Protein: ENSMUSP00000142749
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
SCOP:d1eula_ 5 180 9e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126664
SMART Domains Protein: ENSMUSP00000143594
Gene: ENSMUSG00000046808

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 111 176 1.2e-21 PFAM
Pfam:E1-E2_ATPase 181 450 3e-10 PFAM
low complexity region 523 534 N/A INTRINSIC
low complexity region 684 696 N/A INTRINSIC
Pfam:Cation_ATPase 739 859 3.4e-7 PFAM
Pfam:HAD 754 1114 1.3e-12 PFAM
Pfam:PhoLip_ATPase_C 1131 1376 4.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158570
Predicted Effect probably null
Transcript: ENSMUST00000167460
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175766
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176974
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177290
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Meta Mutation Damage Score 0.9470 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,520,536 (GRCm39) probably benign Het
Abcg8 G C 17: 84,994,155 (GRCm39) probably benign Het
Abhd15 C T 11: 77,406,236 (GRCm39) A71V probably damaging Het
AC167973.1 A T 9: 43,176,649 (GRCm39) noncoding transcript Het
Adamts12 T C 15: 11,311,445 (GRCm39) F1234S probably benign Het
Ahnak A G 19: 8,993,239 (GRCm39) D4841G probably damaging Het
Akap13 T C 7: 75,378,797 (GRCm39) S2095P possibly damaging Het
Ampd2 T C 3: 107,987,653 (GRCm39) probably null Het
Arhgef17 G T 7: 100,578,866 (GRCm39) P694Q possibly damaging Het
Arrdc1 T C 2: 24,815,807 (GRCm39) I398V probably benign Het
Ash1l T C 3: 88,959,372 (GRCm39) Y2250H probably damaging Het
Aspg A G 12: 112,088,286 (GRCm39) N385D probably benign Het
Atxn3 G A 12: 101,892,758 (GRCm39) R319C possibly damaging Het
Brca2 G A 5: 150,475,723 (GRCm39) A2478T probably damaging Het
Btrc T A 19: 45,501,821 (GRCm39) probably benign Het
C1s1 C T 6: 124,508,090 (GRCm39) C633Y probably damaging Het
C8g C T 2: 25,390,228 (GRCm39) A6T probably benign Het
Capza2 T C 6: 17,657,158 (GRCm39) probably benign Het
Cbl A T 9: 44,065,541 (GRCm39) V706E probably benign Het
Ccdc121rt3 C T 5: 112,502,630 (GRCm39) G358D probably benign Het
Cenatac A T 9: 44,324,977 (GRCm39) probably benign Het
Cfhr1 C T 1: 139,485,312 (GRCm39) E45K probably benign Het
Chd7 G A 4: 8,840,561 (GRCm39) probably null Het
Chek1 G T 9: 36,637,153 (GRCm39) A2E probably damaging Het
Clcn2 G A 16: 20,531,302 (GRCm39) probably benign Het
Cndp2 G A 18: 84,695,440 (GRCm39) probably benign Het
Cntnap1 C A 11: 101,071,186 (GRCm39) F366L probably damaging Het
Col5a1 G T 2: 27,893,858 (GRCm39) probably benign Het
Crb2 T C 2: 37,673,400 (GRCm39) Y99H probably damaging Het
Csf3r T A 4: 125,925,725 (GRCm39) probably benign Het
Ctdspl2 G A 2: 121,834,410 (GRCm39) R332K probably benign Het
Ctnnbl1 C T 2: 157,641,337 (GRCm39) probably benign Het
Cym G A 3: 107,120,774 (GRCm39) T277I probably damaging Het
Cyp2d11 C T 15: 82,275,936 (GRCm39) C215Y probably benign Het
Dido1 G A 2: 180,304,121 (GRCm39) P1261L probably damaging Het
Dnah10 T A 5: 124,840,160 (GRCm39) Y1265N probably benign Het
Dtx3l G A 16: 35,753,098 (GRCm39) L503F probably damaging Het
Eda T A X: 99,435,998 (GRCm39) probably benign Homo
Efhb A G 17: 53,744,206 (GRCm39) F462L probably damaging Het
Enpep T A 3: 129,113,097 (GRCm39) T203S probably damaging Het
Exd1 G A 2: 119,351,215 (GRCm39) probably benign Het
Fam184b G A 5: 45,737,851 (GRCm39) probably benign Het
Fam20b T C 1: 156,513,758 (GRCm39) probably benign Het
Fat3 A C 9: 16,286,778 (GRCm39) V915G probably damaging Het
Fbln7 A G 2: 128,719,349 (GRCm39) T49A probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fgf14 T A 14: 124,913,951 (GRCm39) K60M probably benign Het
Galnt4 A G 10: 98,944,571 (GRCm39) R99G probably benign Het
Gimap4 C A 6: 48,668,216 (GRCm39) Q196K probably benign Het
Glcci1 C T 6: 8,537,964 (GRCm39) T6I probably damaging Het
Gm10110 A T 14: 90,135,511 (GRCm39) noncoding transcript Het
Gm4884 A G 7: 40,692,552 (GRCm39) K174E probably damaging Het
Grip2 A T 6: 91,765,424 (GRCm39) D19E probably damaging Het
Grk4 T C 5: 34,852,094 (GRCm39) S113P probably benign Het
Hectd3 G A 4: 116,853,763 (GRCm39) E220K probably damaging Het
Helz2 G A 2: 180,878,090 (GRCm39) P903S probably damaging Het
Hydin T A 8: 111,259,585 (GRCm39) V2519E possibly damaging Het
Igf2r A T 17: 12,936,156 (GRCm39) probably benign Het
Ints11 G A 4: 155,972,567 (GRCm39) probably null Het
Kif1a A G 1: 92,982,651 (GRCm39) W718R possibly damaging Het
Kif1b A T 4: 149,307,709 (GRCm39) Y839N probably damaging Het
Kif20b T A 19: 34,927,999 (GRCm39) V1047D probably benign Het
Klhl23 T C 2: 69,664,232 (GRCm39) I527T probably damaging Het
Klra10 T A 6: 130,256,278 (GRCm39) R125S probably damaging Het
Klra10 T C 6: 130,256,394 (GRCm39) N87D probably damaging Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lcn4 G A 2: 26,558,588 (GRCm39) P166L probably damaging Het
Letmd1 T A 15: 100,370,423 (GRCm39) probably null Het
Lrrc27 A G 7: 138,810,224 (GRCm39) probably benign Het
Map4k2 G T 19: 6,391,947 (GRCm39) W87L probably damaging Het
Mccc1 A G 3: 36,028,435 (GRCm39) V457A probably benign Het
Mdn1 T A 4: 32,730,788 (GRCm39) S2886T probably benign Het
Mgat4a A T 1: 37,503,487 (GRCm39) probably benign Het
Mmp1b A T 9: 7,384,779 (GRCm39) probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mrpl24 T A 3: 87,829,235 (GRCm39) Y21* probably null Het
Mrps35 C T 6: 146,957,482 (GRCm39) T169M probably damaging Het
Mtcl1 T A 17: 66,687,430 (GRCm39) D492V probably damaging Het
Muc2 A G 7: 141,302,711 (GRCm39) Y457C probably damaging Het
Muc4 G A 16: 32,574,886 (GRCm39) G1157D probably benign Het
Myg1 T A 15: 102,245,825 (GRCm39) L275Q probably damaging Het
Naga T A 15: 82,218,989 (GRCm39) M237L probably null Het
Nek1 C T 8: 61,578,170 (GRCm39) probably benign Het
Oc90 T A 15: 65,769,569 (GRCm39) Y96F probably damaging Het
Or12d13 A T 17: 37,647,847 (GRCm39) L92H probably benign Het
Or13a18 A G 7: 140,190,882 (GRCm39) I268V probably benign Het
Or4a80 C T 2: 89,582,611 (GRCm39) C187Y probably damaging Het
Or5m11b T A 2: 85,806,339 (GRCm39) F251I probably damaging Het
Or6ae1 A G 7: 139,742,116 (GRCm39) V249A probably damaging Het
Orc4 A T 2: 48,799,506 (GRCm39) C324S possibly damaging Het
Pald1 T C 10: 61,184,304 (GRCm39) probably benign Het
Paox A G 7: 139,709,194 (GRCm39) probably benign Het
Pcdh10 T G 3: 45,334,409 (GRCm39) L241R probably damaging Het
Pdzrn4 T C 15: 92,668,418 (GRCm39) S857P probably benign Het
Plec C T 15: 76,070,108 (GRCm39) E1000K possibly damaging Het
Plvap A T 8: 71,961,125 (GRCm39) V149D probably benign Het
Ppef1 C A X: 159,408,670 (GRCm39) probably null Homo
Prkaa1 C A 15: 5,208,279 (GRCm39) P507T probably benign Het
Psmd2 A G 16: 20,476,715 (GRCm39) probably benign Het
Ptch1 A G 13: 63,672,783 (GRCm39) Y804H probably benign Het
R3hdm2 A G 10: 127,312,559 (GRCm39) I434V probably benign Het
Rbm28 G A 6: 29,155,016 (GRCm39) probably benign Het
Rfx5 T A 3: 94,863,614 (GRCm39) Y88N probably damaging Het
Rnase2b A T 14: 51,400,296 (GRCm39) K126* probably null Het
Rpl3l A G 17: 24,949,845 (GRCm39) I15V probably benign Het
Saal1 G T 7: 46,351,969 (GRCm39) probably null Het
Sbpl A C 17: 24,172,228 (GRCm39) D230E unknown Het
Scn10a T C 9: 119,495,556 (GRCm39) Y322C probably damaging Het
Sec16a A T 2: 26,321,169 (GRCm39) Y1308N probably damaging Het
Sis A T 3: 72,839,393 (GRCm39) D824E possibly damaging Het
Slc25a36 A G 9: 96,962,408 (GRCm39) F194L probably damaging Het
Slc27a4 T A 2: 29,701,202 (GRCm39) V331E probably damaging Het
Slc7a11 G T 3: 50,335,522 (GRCm39) probably null Het
Slco4c1 A T 1: 96,768,897 (GRCm39) S322T probably damaging Het
Smarcc2 A T 10: 128,310,114 (GRCm39) T376S probably damaging Het
Srebf1 C T 11: 60,091,528 (GRCm39) R999H probably benign Het
St3gal3 A C 4: 117,964,859 (GRCm39) M1R probably null Het
Syp A T X: 7,514,944 (GRCm39) probably benign Homo
Tas1r2 A G 4: 139,396,722 (GRCm39) D687G probably damaging Het
Tekt4 A T 17: 25,691,048 (GRCm39) Q118L probably benign Het
Thoc2l T A 5: 104,666,123 (GRCm39) I215N probably damaging Het
Tph2 T C 10: 114,915,600 (GRCm39) N480S probably benign Het
Tsc2 A T 17: 24,827,947 (GRCm39) M839K probably damaging Het
Ttc22 T C 4: 106,479,977 (GRCm39) F77S probably damaging Het
Uaca C T 9: 60,761,603 (GRCm39) A205V possibly damaging Het
Ubp1 T G 9: 113,773,903 (GRCm39) probably benign Het
Uhmk1 A T 1: 170,036,222 (GRCm39) probably null Het
Usp17lc A G 7: 103,068,148 (GRCm39) H481R possibly damaging Het
Vwa3a A G 7: 120,367,388 (GRCm39) Y181C probably damaging Het
Wdr26 C T 1: 181,013,499 (GRCm39) probably benign Het
Wfikkn2 G A 11: 94,129,721 (GRCm39) T140I probably damaging Het
Zfp704 G T 3: 9,512,408 (GRCm39) T288N possibly damaging Het
Zfp93 T C 7: 23,975,521 (GRCm39) V502A probably damaging Het
Zzef1 C T 11: 72,815,505 (GRCm39) P2942S probably damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72,462,231 (GRCm39) missense probably damaging 1.00
IGL01114:Corin APN 5 72,462,354 (GRCm39) missense probably damaging 1.00
IGL01351:Corin APN 5 72,496,334 (GRCm39) missense probably damaging 1.00
IGL01516:Corin APN 5 72,611,830 (GRCm39) nonsense probably null
IGL01785:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01786:Corin APN 5 72,497,219 (GRCm39) missense probably damaging 1.00
IGL01845:Corin APN 5 72,511,282 (GRCm39) missense probably damaging 1.00
IGL02097:Corin APN 5 72,529,489 (GRCm39) missense probably damaging 1.00
IGL02629:Corin APN 5 72,490,016 (GRCm39) missense probably damaging 1.00
IGL03085:Corin APN 5 72,511,273 (GRCm39) missense probably damaging 1.00
IGL03120:Corin APN 5 72,518,032 (GRCm39) missense probably damaging 1.00
IGL03150:Corin APN 5 72,460,201 (GRCm39) missense probably damaging 1.00
IGL03183:Corin APN 5 72,458,929 (GRCm39) missense probably damaging 0.99
IGL03185:Corin APN 5 72,490,124 (GRCm39) missense probably damaging 1.00
IGL03408:Corin APN 5 72,500,304 (GRCm39) missense probably benign 0.40
alpaca UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R0078:Corin UTSW 5 72,611,816 (GRCm39) missense possibly damaging 0.77
R0724:Corin UTSW 5 72,490,138 (GRCm39) splice site probably benign
R1065:Corin UTSW 5 72,458,993 (GRCm39) nonsense probably null
R1301:Corin UTSW 5 72,462,276 (GRCm39) missense possibly damaging 0.81
R1466:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1520:Corin UTSW 5 72,488,238 (GRCm39) missense probably damaging 1.00
R1584:Corin UTSW 5 72,460,133 (GRCm39) critical splice donor site probably null
R1617:Corin UTSW 5 72,661,295 (GRCm39) missense possibly damaging 0.85
R1912:Corin UTSW 5 72,515,746 (GRCm39) missense probably damaging 1.00
R2059:Corin UTSW 5 72,473,394 (GRCm39) missense possibly damaging 0.76
R2173:Corin UTSW 5 72,661,422 (GRCm39) missense probably benign 0.01
R2242:Corin UTSW 5 72,490,054 (GRCm39) missense probably damaging 1.00
R2373:Corin UTSW 5 72,496,381 (GRCm39) missense probably damaging 1.00
R2850:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R3683:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3684:Corin UTSW 5 72,488,198 (GRCm39) missense probably damaging 1.00
R3790:Corin UTSW 5 72,592,641 (GRCm39) missense probably benign 0.38
R3847:Corin UTSW 5 72,579,508 (GRCm39) missense probably benign 0.13
R3926:Corin UTSW 5 72,529,473 (GRCm39) missense probably damaging 1.00
R3939:Corin UTSW 5 72,497,222 (GRCm39) missense possibly damaging 0.80
R3945:Corin UTSW 5 72,515,767 (GRCm39) missense probably damaging 1.00
R4079:Corin UTSW 5 72,661,226 (GRCm39) missense probably benign 0.03
R4224:Corin UTSW 5 72,500,451 (GRCm39) missense probably damaging 1.00
R4473:Corin UTSW 5 72,496,400 (GRCm39) missense probably damaging 1.00
R4585:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4586:Corin UTSW 5 72,487,042 (GRCm39) missense probably damaging 1.00
R4849:Corin UTSW 5 72,460,178 (GRCm39) missense probably damaging 1.00
R4926:Corin UTSW 5 72,529,525 (GRCm39) missense probably damaging 1.00
R5080:Corin UTSW 5 72,511,194 (GRCm39) intron probably benign
R5138:Corin UTSW 5 72,496,402 (GRCm39) missense probably damaging 1.00
R5262:Corin UTSW 5 72,462,298 (GRCm39) missense probably damaging 1.00
R5268:Corin UTSW 5 72,500,362 (GRCm39) missense probably damaging 1.00
R5302:Corin UTSW 5 72,473,441 (GRCm39) missense probably benign 0.07
R5307:Corin UTSW 5 72,514,321 (GRCm39) missense probably damaging 1.00
R5324:Corin UTSW 5 72,592,600 (GRCm39) missense probably damaging 1.00
R5352:Corin UTSW 5 72,462,376 (GRCm39) missense probably benign 0.04
R5373:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5374:Corin UTSW 5 72,462,296 (GRCm39) missense probably damaging 1.00
R5484:Corin UTSW 5 72,515,827 (GRCm39) missense probably benign 0.15
R5502:Corin UTSW 5 72,473,449 (GRCm39) nonsense probably null
R5544:Corin UTSW 5 72,462,357 (GRCm39) nonsense probably null
R5682:Corin UTSW 5 72,579,497 (GRCm39) missense possibly damaging 0.85
R5818:Corin UTSW 5 72,592,738 (GRCm39) missense probably benign 0.00
R5992:Corin UTSW 5 72,473,732 (GRCm39) missense probably benign 0.01
R6115:Corin UTSW 5 72,518,072 (GRCm39) missense probably damaging 1.00
R6181:Corin UTSW 5 72,529,439 (GRCm39) critical splice donor site probably null
R6317:Corin UTSW 5 72,496,388 (GRCm39) missense probably damaging 1.00
R7053:Corin UTSW 5 72,458,870 (GRCm39) missense probably benign 0.28
R7242:Corin UTSW 5 72,462,398 (GRCm39) missense probably benign 0.14
R7452:Corin UTSW 5 72,592,590 (GRCm39) missense possibly damaging 0.94
R7783:Corin UTSW 5 72,458,967 (GRCm39) missense probably benign 0.26
R7903:Corin UTSW 5 72,458,843 (GRCm39) missense probably benign 0.00
R7956:Corin UTSW 5 72,579,530 (GRCm39) missense probably damaging 0.99
R8007:Corin UTSW 5 72,473,446 (GRCm39) missense probably damaging 0.96
R8125:Corin UTSW 5 72,515,806 (GRCm39) missense probably damaging 0.96
R8215:Corin UTSW 5 72,462,361 (GRCm39) missense probably damaging 1.00
R8251:Corin UTSW 5 72,514,269 (GRCm39) missense probably damaging 1.00
R8364:Corin UTSW 5 72,462,274 (GRCm39) missense probably benign
R8505:Corin UTSW 5 72,592,750 (GRCm39) missense probably benign 0.21
R8746:Corin UTSW 5 72,592,695 (GRCm39) missense probably benign 0.31
R8887:Corin UTSW 5 72,486,953 (GRCm39) critical splice donor site probably null
R9484:Corin UTSW 5 72,497,280 (GRCm39) missense probably damaging 1.00
R9640:Corin UTSW 5 72,592,597 (GRCm39) missense probably benign
Z1177:Corin UTSW 5 72,611,836 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTTATACATGGCAATGCCCTCTG -3'
(R):5'- CTTTGAACGCAGTGCCCTTTAAGC -3'

Sequencing Primer
(F):5'- CTGCTTAAGACAGTGGATTTGAAG -3'
(R):5'- GATCTGTGCTGGCTATGAGT -3'
Posted On 2014-05-23