Mutagenetix > Incidental Mutation

Incidental Mutation 'R0090:Nup210l'

20120

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

038377-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R0090 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 90211779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1832 (V1832I)

Ref Sequence

ENSEMBL: ENSMUSP00000143368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000107373] [ENSMUST00000170122] [ENSMUST00000195998] [ENSMUST00000196205] [ENSMUST00000197361] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: V1832I

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107373

SMART Domains

Protein: ENSMUSP00000102996
Gene: ENSMUSG00000027935

Domain	Start	End	E-Value	Type
Pfam:Miro	1	43	3.5e-6	PFAM
Pfam:Arf	1	88	1.8e-5	PFAM
Pfam:Ras	1	90	2.5e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170122

SMART Domains

Protein: ENSMUSP00000132102
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
Pfam:Ribosomal_S27e	28	82	9.8e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195998

SMART Domains

Protein: ENSMUSP00000142942
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S27e	1	50	3e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196196

Predicted Effect

probably benign
Transcript: ENSMUST00000196205

SMART Domains

Protein: ENSMUSP00000142536
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
Pfam:Ribosomal_S27e	26	80	7.5e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197028

Predicted Effect

probably benign
Transcript: ENSMUST00000197361

SMART Domains

Protein: ENSMUSP00000143402
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
Pfam:Ribosomal_S27e	28	80	5.7e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199031

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199428

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200305

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: V1832I

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.7%
20x: 91.4%

Validation Efficiency

99% (90/91)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159		probably benign	Het
4933427I04Rik	A	G	4: 123,860,982	T230A	possibly damaging	Het
9230110C19Rik	T	A	9: 8,027,183	N118I	probably benign	Het
Acsm1	T	C	7: 119,662,189		probably benign	Het
Acta1	T	C	8: 123,893,657	N14S	probably damaging	Het
Aff4	A	G	11: 53,392,782	T362A	probably benign	Het
Aggf1	A	G	13: 95,364,959	I305T	probably benign	Het
Ap4b1	A	G	3: 103,820,429	D325G	possibly damaging	Het
Ap4e1	C	T	2: 127,064,985	T1055I	possibly damaging	Het
Arhgef2	A	T	3: 88,639,348	Q496L	probably damaging	Het
Arhgef28	A	G	13: 98,075,110	F122L	probably damaging	Het
Baiap3	G	A	17: 25,250,070		probably benign	Het
Casp8ap2	T	A	4: 32,640,327	H460Q	probably damaging	Het
Casz1	A	G	4: 148,933,411	T386A	probably benign	Het
Cd53	A	T	3: 106,767,409	V114E	possibly damaging	Het
Celsr2	A	G	3: 108,393,327		probably benign	Het
Chaf1b	G	T	16: 93,887,124	A88S	possibly damaging	Het
Cldn10	A	T	14: 118,874,200	Y194F	probably damaging	Het
Clec2e	A	C	6: 129,095,218		probably null	Het
Cmpk2	A	T	12: 26,478,022	T413S	probably benign	Het
Col9a1	T	A	1: 24,223,562		probably null	Het
Dchs1	G	T	7: 105,755,932	Q2468K	probably benign	Het
Ddx60	A	G	8: 61,942,293	D88G	probably damaging	Het
Dnah8	A	G	17: 30,784,090	R3588G	probably benign	Het
Ect2	T	C	3: 27,115,476	T774A	probably benign	Het
Ect2	C	T	3: 27,138,502	E431K	probably null	Het
Ern1	A	G	11: 106,405,823	V767A	probably damaging	Het
Fbln1	A	C	15: 85,224,288	E75A	possibly damaging	Het
Fgf5	C	T	5: 98,261,987	R132*	probably null	Het
Folh1	T	C	7: 86,725,868		probably benign	Het
Gdf15	A	T	8: 70,629,684	H257Q	probably damaging	Het
Ghitm	T	C	14: 37,122,219	T322A	probably benign	Het
Gm13212	A	T	4: 145,622,625	K211*	probably null	Het
Gm5709	A	G	3: 59,618,771		noncoding transcript	Het
Hbb-y	C	T	7: 103,852,743		probably null	Het
Hmcn2	A	T	2: 31,426,198	D3771V	probably damaging	Het
Hspa12a	T	C	19: 58,799,509	D627G	probably benign	Het
Idh2	T	C	7: 80,097,914	E286G	probably damaging	Het
Idh3b	C	A	2: 130,280,979	A297S	probably benign	Het
Igsf3	A	G	3: 101,435,652	E535G	probably damaging	Het
Ilf3	T	A	9: 21,395,414	D314E	probably damaging	Het
Itgb8	A	G	12: 119,202,563	S78P	probably benign	Het
Itih5	G	A	2: 10,164,684	V31I	probably benign	Het
Kcnj2	T	C	11: 111,073,027	V415A	probably benign	Het
Kin	A	G	2: 10,085,773	Q53R	possibly damaging	Het
Krt78	A	T	15: 101,947,837	M513K	probably benign	Het
Krtap4-8	A	T	11: 99,780,486		probably benign	Het
Ltbr	T	C	6: 125,309,449		probably benign	Het
Mgat4a	G	A	1: 37,490,333	T146I	probably damaging	Het
Mrps2	G	C	2: 28,468,256	W19C	probably damaging	Het
Mthfs	T	C	9: 89,211,291	S33P	probably damaging	Het
Myh6	T	C	14: 54,958,704	D546G	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Ndst2	T	C	14: 20,727,267	T553A	probably damaging	Het
Nlrp12	T	C	7: 3,240,034	E616G	probably damaging	Het
Nrde2	T	C	12: 100,129,286		probably benign	Het
Olfr1283	A	T	2: 111,369,294	I221F	probably damaging	Het
Olfr376	G	A	11: 73,375,576	V276I	probably benign	Het
Pcm1	A	T	8: 41,256,041	E9D	probably damaging	Het
Pear1	A	T	3: 87,754,342	D541E	possibly damaging	Het
Peg10	A	G	6: 4,756,063		probably benign	Het
Prss1	G	A	6: 41,461,232	R31Q	probably benign	Het
Ptpn13	T	C	5: 103,569,503	V1837A	probably damaging	Het
Rasgrp3	A	G	17: 75,498,461	D149G	probably damaging	Het
Reg3d	A	T	6: 78,378,483	H8Q	possibly damaging	Het
Rhox4f	A	C	X: 37,607,469	V15G	probably benign	Het
Sacs	T	A	14: 61,205,440	L1645H	probably damaging	Het
Slc16a5	A	T	11: 115,464,925	S71C	probably damaging	Het
Slc9a3	A	G	13: 74,158,728	E324G	probably damaging	Het
Smgc	T	C	15: 91,859,762	V574A	possibly damaging	Het
Stac3	C	T	10: 127,503,930		probably benign	Het
Supv3l1	A	G	10: 62,429,706	L685P	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tas2r125	G	T	6: 132,910,398	A250S	probably benign	Het
Tdrd6	C	T	17: 43,628,241	V639I	probably benign	Het
Thap12	T	G	7: 98,715,893	W423G	probably damaging	Het
Tmem245	T	C	4: 56,899,410	I217V	probably benign	Het
Trip12	T	A	1: 84,732,136		probably benign	Het
Tshz3	T	C	7: 36,768,892	V102A	probably benign	Het
Ubap1	T	C	4: 41,379,826	S347P	probably damaging	Het
Usp10	C	T	8: 119,953,196	Q612*	probably null	Het
Vmn2r72	T	C	7: 85,754,876	I36V	probably benign	Het
Vps37a	T	C	8: 40,526,989	I63T	possibly damaging	Het
Whrn	C	A	4: 63,432,732	R9L	possibly damaging	Het
Xrcc1	T	C	7: 24,570,217	Y401H	probably damaging	Het
Ylpm1	GCCTAAGCAGCAACCTAAG	GCCTAAG	12: 85,029,040		probably benign	Het
Zfhx3	G	A	8: 108,950,057	D2580N	possibly damaging	Het
Zfhx4	A	G	3: 5,243,625	N637S	probably damaging	Het
Zyg11a	A	T	4: 108,201,347		probably benign	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTATCAGCATACAGGGCAGTTTAGAGG -3'
(R):5'- CCATAACCAGTGTTGTAGCCGACTC -3'

Sequencing Primer
(F):5'- aatcccagaatcccagcac -3'
(R):5'- AGGTCTTTACCTGGCTGAGT -3'

Posted On

2013-04-11