Incidental Mutation 'R0090:Nup210l'
ID 20120
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 038377-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R0090 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90119086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1832 (V1832I)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000107373] [ENSMUST00000170122] [ENSMUST00000195998] [ENSMUST00000196205] [ENSMUST00000197361] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: V1832I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107373
SMART Domains Protein: ENSMUSP00000102996
Gene: ENSMUSG00000027935

DomainStartEndE-ValueType
Pfam:Miro 1 43 3.5e-6 PFAM
Pfam:Arf 1 88 1.8e-5 PFAM
Pfam:Ras 1 90 2.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170122
SMART Domains Protein: ENSMUSP00000132102
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 82 9.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195998
SMART Domains Protein: ENSMUSP00000142942
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
Pfam:Ribosomal_S27e 1 50 3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196196
Predicted Effect probably benign
Transcript: ENSMUST00000196205
SMART Domains Protein: ENSMUSP00000142536
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
Pfam:Ribosomal_S27e 26 80 7.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197028
Predicted Effect probably benign
Transcript: ENSMUST00000197361
SMART Domains Protein: ENSMUSP00000143402
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 80 5.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198809
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: V1832I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199031
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
4933427I04Rik A G 4: 123,754,775 (GRCm39) T230A possibly damaging Het
Acsm1 T C 7: 119,261,412 (GRCm39) probably benign Het
Acta1 T C 8: 124,620,396 (GRCm39) N14S probably damaging Het
Aff4 A G 11: 53,283,609 (GRCm39) T362A probably benign Het
Aggf1 A G 13: 95,501,467 (GRCm39) I305T probably benign Het
Ap4b1 A G 3: 103,727,745 (GRCm39) D325G possibly damaging Het
Ap4e1 C T 2: 126,906,905 (GRCm39) T1055I possibly damaging Het
Arhgef2 A T 3: 88,546,655 (GRCm39) Q496L probably damaging Het
Arhgef28 A G 13: 98,211,618 (GRCm39) F122L probably damaging Het
Baiap3 G A 17: 25,469,044 (GRCm39) probably benign Het
Casp8ap2 T A 4: 32,640,327 (GRCm39) H460Q probably damaging Het
Casz1 A G 4: 149,017,868 (GRCm39) T386A probably benign Het
Cd53 A T 3: 106,674,725 (GRCm39) V114E possibly damaging Het
Celsr2 A G 3: 108,300,643 (GRCm39) probably benign Het
Cfap300 T A 9: 8,027,184 (GRCm39) N118I probably benign Het
Chaf1b G T 16: 93,684,012 (GRCm39) A88S possibly damaging Het
Cldn10 A T 14: 119,111,612 (GRCm39) Y194F probably damaging Het
Clec2e A C 6: 129,072,181 (GRCm39) probably null Het
Cmpk2 A T 12: 26,528,021 (GRCm39) T413S probably benign Het
Col9a1 T A 1: 24,262,643 (GRCm39) probably null Het
Dchs1 G T 7: 105,405,139 (GRCm39) Q2468K probably benign Het
Ddx60 A G 8: 62,395,327 (GRCm39) D88G probably damaging Het
Dnah8 A G 17: 31,003,064 (GRCm39) R3588G probably benign Het
Ect2 T C 3: 27,169,625 (GRCm39) T774A probably benign Het
Ect2 C T 3: 27,192,651 (GRCm39) E431K probably null Het
Ern1 A G 11: 106,296,649 (GRCm39) V767A probably damaging Het
Fbln1 A C 15: 85,108,489 (GRCm39) E75A possibly damaging Het
Fgf5 C T 5: 98,409,846 (GRCm39) R132* probably null Het
Folh1 T C 7: 86,375,076 (GRCm39) probably benign Het
Gdf15 A T 8: 71,082,334 (GRCm39) H257Q probably damaging Het
Ghitm T C 14: 36,844,176 (GRCm39) T322A probably benign Het
Gm5709 A G 3: 59,526,192 (GRCm39) noncoding transcript Het
Hbb-y C T 7: 103,501,950 (GRCm39) probably null Het
Hmcn2 A T 2: 31,316,210 (GRCm39) D3771V probably damaging Het
Hspa12a T C 19: 58,787,941 (GRCm39) D627G probably benign Het
Idh2 T C 7: 79,747,662 (GRCm39) E286G probably damaging Het
Idh3b C A 2: 130,122,899 (GRCm39) A297S probably benign Het
Igsf3 A G 3: 101,342,968 (GRCm39) E535G probably damaging Het
Ilf3 T A 9: 21,306,710 (GRCm39) D314E probably damaging Het
Itgb8 A G 12: 119,166,298 (GRCm39) S78P probably benign Het
Itih5 G A 2: 10,169,495 (GRCm39) V31I probably benign Het
Kcnj2 T C 11: 110,963,853 (GRCm39) V415A probably benign Het
Kin A G 2: 10,090,584 (GRCm39) Q53R possibly damaging Het
Krt78 A T 15: 101,856,272 (GRCm39) M513K probably benign Het
Krtap4-8 A T 11: 99,671,312 (GRCm39) probably benign Het
Ltbr T C 6: 125,286,412 (GRCm39) probably benign Het
Mgat4a G A 1: 37,529,414 (GRCm39) T146I probably damaging Het
Mrps2 G C 2: 28,358,268 (GRCm39) W19C probably damaging Het
Mthfs T C 9: 89,093,344 (GRCm39) S33P probably damaging Het
Myh6 T C 14: 55,196,161 (GRCm39) D546G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Ndst2 T C 14: 20,777,335 (GRCm39) T553A probably damaging Het
Nlrp12 T C 7: 3,288,664 (GRCm39) E616G probably damaging Het
Nrde2 T C 12: 100,095,545 (GRCm39) probably benign Het
Or1e1c G A 11: 73,266,402 (GRCm39) V276I probably benign Het
Or4k77 A T 2: 111,199,639 (GRCm39) I221F probably damaging Het
Pcm1 A T 8: 41,709,078 (GRCm39) E9D probably damaging Het
Pear1 A T 3: 87,661,649 (GRCm39) D541E possibly damaging Het
Peg10 A G 6: 4,756,063 (GRCm39) probably benign Het
Prss1 G A 6: 41,438,166 (GRCm39) R31Q probably benign Het
Ptpn13 T C 5: 103,717,369 (GRCm39) V1837A probably damaging Het
Rasgrp3 A G 17: 75,805,456 (GRCm39) D149G probably damaging Het
Reg3d A T 6: 78,355,466 (GRCm39) H8Q possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Sacs T A 14: 61,442,889 (GRCm39) L1645H probably damaging Het
Slc16a5 A T 11: 115,355,751 (GRCm39) S71C probably damaging Het
Slc9a3 A G 13: 74,306,847 (GRCm39) E324G probably damaging Het
Smgc T C 15: 91,743,960 (GRCm39) V574A possibly damaging Het
Stac3 C T 10: 127,339,799 (GRCm39) probably benign Het
Supv3l1 A G 10: 62,265,485 (GRCm39) L685P probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tas2r125 G T 6: 132,887,361 (GRCm39) A250S probably benign Het
Tdrd6 C T 17: 43,939,132 (GRCm39) V639I probably benign Het
Thap12 T G 7: 98,365,100 (GRCm39) W423G probably damaging Het
Tmem245 T C 4: 56,899,410 (GRCm39) I217V probably benign Het
Trip12 T A 1: 84,709,857 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,317 (GRCm39) V102A probably benign Het
Ubap1 T C 4: 41,379,826 (GRCm39) S347P probably damaging Het
Usp10 C T 8: 120,679,935 (GRCm39) Q612* probably null Het
Vmn2r72 T C 7: 85,404,084 (GRCm39) I36V probably benign Het
Vps37a T C 8: 40,980,030 (GRCm39) I63T possibly damaging Het
Whrn C A 4: 63,350,969 (GRCm39) R9L possibly damaging Het
Xrcc1 T C 7: 24,269,642 (GRCm39) Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,075,814 (GRCm39) probably benign Het
Zfhx3 G A 8: 109,676,689 (GRCm39) D2580N possibly damaging Het
Zfhx4 A G 3: 5,308,685 (GRCm39) N637S probably damaging Het
Zfp268 A T 4: 145,349,195 (GRCm39) K211* probably null Het
Zyg11a A T 4: 108,058,544 (GRCm39) probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8770:Nup210l UTSW 3 90,025,850 (GRCm39) missense probably damaging 1.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTATCAGCATACAGGGCAGTTTAGAGG -3'
(R):5'- CCATAACCAGTGTTGTAGCCGACTC -3'

Sequencing Primer
(F):5'- aatcccagaatcccagcac -3'
(R):5'- AGGTCTTTACCTGGCTGAGT -3'
Posted On 2013-04-11