Incidental Mutation 'R0090:Nup210l'
ID20120
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Namenucleoporin 210-like
Synonyms4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location90104132-90212048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90211779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1832 (V1832I)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000107373] [ENSMUST00000170122] [ENSMUST00000195998] [ENSMUST00000196205] [ENSMUST00000197361] [ENSMUST00000200410]
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: V1832I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107373
SMART Domains Protein: ENSMUSP00000102996
Gene: ENSMUSG00000027935

DomainStartEndE-ValueType
Pfam:Miro 1 43 3.5e-6 PFAM
Pfam:Arf 1 88 1.8e-5 PFAM
Pfam:Ras 1 90 2.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170122
SMART Domains Protein: ENSMUSP00000132102
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 82 9.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195998
SMART Domains Protein: ENSMUSP00000142942
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
Pfam:Ribosomal_S27e 1 50 3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196196
Predicted Effect probably benign
Transcript: ENSMUST00000196205
SMART Domains Protein: ENSMUSP00000142536
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
Pfam:Ribosomal_S27e 26 80 7.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197028
Predicted Effect probably benign
Transcript: ENSMUST00000197361
SMART Domains Protein: ENSMUSP00000143402
Gene: ENSMUSG00000090733

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:Ribosomal_S27e 28 80 5.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200305
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: V1832I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: V1832I

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vmn2r72 T C 7: 85,754,876 I36V probably benign Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 intron probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R7923:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7930:Nup210l UTSW 3 90151123 missense probably benign
R7931:Nup210l UTSW 3 90203905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATCAGCATACAGGGCAGTTTAGAGG -3'
(R):5'- CCATAACCAGTGTTGTAGCCGACTC -3'

Sequencing Primer
(F):5'- aatcccagaatcccagcac -3'
(R):5'- AGGTCTTTACCTGGCTGAGT -3'
Posted On2013-04-11