Incidental Mutation 'R0090:Igsf3'
ID 20121
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Name immunoglobulin superfamily, member 3
Synonyms 1700016K10Rik, 2810035F16Rik, 4833439O17Rik
MMRRC Submission 038377-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.250) question?
Stock # R0090 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 101284399-101370375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101342968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 535 (E535G)
Ref Sequence ENSEMBL: ENSMUSP00000141823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
AlphaFold Q6ZQA6
Predicted Effect probably damaging
Transcript: ENSMUST00000043983
AA Change: E515G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035
AA Change: E515G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195164
AA Change: E535G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035
AA Change: E535G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Meta Mutation Damage Score 0.4431 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
4933427I04Rik A G 4: 123,754,775 (GRCm39) T230A possibly damaging Het
Acsm1 T C 7: 119,261,412 (GRCm39) probably benign Het
Acta1 T C 8: 124,620,396 (GRCm39) N14S probably damaging Het
Aff4 A G 11: 53,283,609 (GRCm39) T362A probably benign Het
Aggf1 A G 13: 95,501,467 (GRCm39) I305T probably benign Het
Ap4b1 A G 3: 103,727,745 (GRCm39) D325G possibly damaging Het
Ap4e1 C T 2: 126,906,905 (GRCm39) T1055I possibly damaging Het
Arhgef2 A T 3: 88,546,655 (GRCm39) Q496L probably damaging Het
Arhgef28 A G 13: 98,211,618 (GRCm39) F122L probably damaging Het
Baiap3 G A 17: 25,469,044 (GRCm39) probably benign Het
Casp8ap2 T A 4: 32,640,327 (GRCm39) H460Q probably damaging Het
Casz1 A G 4: 149,017,868 (GRCm39) T386A probably benign Het
Cd53 A T 3: 106,674,725 (GRCm39) V114E possibly damaging Het
Celsr2 A G 3: 108,300,643 (GRCm39) probably benign Het
Cfap300 T A 9: 8,027,184 (GRCm39) N118I probably benign Het
Chaf1b G T 16: 93,684,012 (GRCm39) A88S possibly damaging Het
Cldn10 A T 14: 119,111,612 (GRCm39) Y194F probably damaging Het
Clec2e A C 6: 129,072,181 (GRCm39) probably null Het
Cmpk2 A T 12: 26,528,021 (GRCm39) T413S probably benign Het
Col9a1 T A 1: 24,262,643 (GRCm39) probably null Het
Dchs1 G T 7: 105,405,139 (GRCm39) Q2468K probably benign Het
Ddx60 A G 8: 62,395,327 (GRCm39) D88G probably damaging Het
Dnah8 A G 17: 31,003,064 (GRCm39) R3588G probably benign Het
Ect2 T C 3: 27,169,625 (GRCm39) T774A probably benign Het
Ect2 C T 3: 27,192,651 (GRCm39) E431K probably null Het
Ern1 A G 11: 106,296,649 (GRCm39) V767A probably damaging Het
Fbln1 A C 15: 85,108,489 (GRCm39) E75A possibly damaging Het
Fgf5 C T 5: 98,409,846 (GRCm39) R132* probably null Het
Folh1 T C 7: 86,375,076 (GRCm39) probably benign Het
Gdf15 A T 8: 71,082,334 (GRCm39) H257Q probably damaging Het
Ghitm T C 14: 36,844,176 (GRCm39) T322A probably benign Het
Gm5709 A G 3: 59,526,192 (GRCm39) noncoding transcript Het
Hbb-y C T 7: 103,501,950 (GRCm39) probably null Het
Hmcn2 A T 2: 31,316,210 (GRCm39) D3771V probably damaging Het
Hspa12a T C 19: 58,787,941 (GRCm39) D627G probably benign Het
Idh2 T C 7: 79,747,662 (GRCm39) E286G probably damaging Het
Idh3b C A 2: 130,122,899 (GRCm39) A297S probably benign Het
Ilf3 T A 9: 21,306,710 (GRCm39) D314E probably damaging Het
Itgb8 A G 12: 119,166,298 (GRCm39) S78P probably benign Het
Itih5 G A 2: 10,169,495 (GRCm39) V31I probably benign Het
Kcnj2 T C 11: 110,963,853 (GRCm39) V415A probably benign Het
Kin A G 2: 10,090,584 (GRCm39) Q53R possibly damaging Het
Krt78 A T 15: 101,856,272 (GRCm39) M513K probably benign Het
Krtap4-8 A T 11: 99,671,312 (GRCm39) probably benign Het
Ltbr T C 6: 125,286,412 (GRCm39) probably benign Het
Mgat4a G A 1: 37,529,414 (GRCm39) T146I probably damaging Het
Mrps2 G C 2: 28,358,268 (GRCm39) W19C probably damaging Het
Mthfs T C 9: 89,093,344 (GRCm39) S33P probably damaging Het
Myh6 T C 14: 55,196,161 (GRCm39) D546G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Ndst2 T C 14: 20,777,335 (GRCm39) T553A probably damaging Het
Nlrp12 T C 7: 3,288,664 (GRCm39) E616G probably damaging Het
Nrde2 T C 12: 100,095,545 (GRCm39) probably benign Het
Nup210l G A 3: 90,119,086 (GRCm39) V1832I probably benign Het
Or1e1c G A 11: 73,266,402 (GRCm39) V276I probably benign Het
Or4k77 A T 2: 111,199,639 (GRCm39) I221F probably damaging Het
Pcm1 A T 8: 41,709,078 (GRCm39) E9D probably damaging Het
Pear1 A T 3: 87,661,649 (GRCm39) D541E possibly damaging Het
Peg10 A G 6: 4,756,063 (GRCm39) probably benign Het
Prss1 G A 6: 41,438,166 (GRCm39) R31Q probably benign Het
Ptpn13 T C 5: 103,717,369 (GRCm39) V1837A probably damaging Het
Rasgrp3 A G 17: 75,805,456 (GRCm39) D149G probably damaging Het
Reg3d A T 6: 78,355,466 (GRCm39) H8Q possibly damaging Het
Rhox4f A C X: 36,789,122 (GRCm39) V15G probably benign Het
Sacs T A 14: 61,442,889 (GRCm39) L1645H probably damaging Het
Slc16a5 A T 11: 115,355,751 (GRCm39) S71C probably damaging Het
Slc9a3 A G 13: 74,306,847 (GRCm39) E324G probably damaging Het
Smgc T C 15: 91,743,960 (GRCm39) V574A possibly damaging Het
Stac3 C T 10: 127,339,799 (GRCm39) probably benign Het
Supv3l1 A G 10: 62,265,485 (GRCm39) L685P probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tas2r125 G T 6: 132,887,361 (GRCm39) A250S probably benign Het
Tdrd6 C T 17: 43,939,132 (GRCm39) V639I probably benign Het
Thap12 T G 7: 98,365,100 (GRCm39) W423G probably damaging Het
Tmem245 T C 4: 56,899,410 (GRCm39) I217V probably benign Het
Trip12 T A 1: 84,709,857 (GRCm39) probably benign Het
Tshz3 T C 7: 36,468,317 (GRCm39) V102A probably benign Het
Ubap1 T C 4: 41,379,826 (GRCm39) S347P probably damaging Het
Usp10 C T 8: 120,679,935 (GRCm39) Q612* probably null Het
Vmn2r72 T C 7: 85,404,084 (GRCm39) I36V probably benign Het
Vps37a T C 8: 40,980,030 (GRCm39) I63T possibly damaging Het
Whrn C A 4: 63,350,969 (GRCm39) R9L possibly damaging Het
Xrcc1 T C 7: 24,269,642 (GRCm39) Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,075,814 (GRCm39) probably benign Het
Zfhx3 G A 8: 109,676,689 (GRCm39) D2580N possibly damaging Het
Zfhx4 A G 3: 5,308,685 (GRCm39) N637S probably damaging Het
Zfp268 A T 4: 145,349,195 (GRCm39) K211* probably null Het
Zyg11a A T 4: 108,058,544 (GRCm39) probably benign Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101,338,555 (GRCm39) missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101,334,764 (GRCm39) splice site probably benign
IGL01321:Igsf3 APN 3 101,334,338 (GRCm39) splice site probably benign
IGL01340:Igsf3 APN 3 101,346,995 (GRCm39) nonsense probably null
IGL02291:Igsf3 APN 3 101,346,845 (GRCm39) missense probably damaging 1.00
Bunsen UTSW 3 101,358,612 (GRCm39) critical splice donor site probably null
residue UTSW 3 101,342,751 (GRCm39) missense probably damaging 0.99
weaksister UTSW 3 101,358,393 (GRCm39) nonsense probably null
PIT4402001:Igsf3 UTSW 3 101,334,393 (GRCm39) missense probably benign 0.00
R0143:Igsf3 UTSW 3 101,342,917 (GRCm39) missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101,342,751 (GRCm39) missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101,334,709 (GRCm39) missense probably benign 0.31
R1195:Igsf3 UTSW 3 101,365,419 (GRCm39) missense probably benign 0.05
R1195:Igsf3 UTSW 3 101,365,419 (GRCm39) missense probably benign 0.05
R1195:Igsf3 UTSW 3 101,365,419 (GRCm39) missense probably benign 0.05
R1384:Igsf3 UTSW 3 101,358,612 (GRCm39) critical splice donor site probably null
R1594:Igsf3 UTSW 3 101,358,393 (GRCm39) nonsense probably null
R1624:Igsf3 UTSW 3 101,362,543 (GRCm39) missense probably benign 0.37
R1766:Igsf3 UTSW 3 101,338,598 (GRCm39) missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101,338,612 (GRCm39) missense probably benign 0.03
R2072:Igsf3 UTSW 3 101,346,831 (GRCm39) missense probably benign 0.02
R4707:Igsf3 UTSW 3 101,365,410 (GRCm39) missense probably benign 0.06
R4976:Igsf3 UTSW 3 101,346,677 (GRCm39) splice site probably null
R4982:Igsf3 UTSW 3 101,342,983 (GRCm39) missense probably benign 0.42
R5008:Igsf3 UTSW 3 101,358,233 (GRCm39) missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101,346,677 (GRCm39) splice site probably null
R5189:Igsf3 UTSW 3 101,338,843 (GRCm39) missense possibly damaging 0.64
R5456:Igsf3 UTSW 3 101,334,537 (GRCm39) missense probably benign 0.20
R5776:Igsf3 UTSW 3 101,332,796 (GRCm39) missense probably benign 0.01
R6112:Igsf3 UTSW 3 101,358,322 (GRCm39) missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101,342,964 (GRCm39) missense probably benign 0.05
R6758:Igsf3 UTSW 3 101,332,814 (GRCm39) missense probably damaging 0.98
R7085:Igsf3 UTSW 3 101,362,805 (GRCm39) missense probably benign 0.12
R7310:Igsf3 UTSW 3 101,338,895 (GRCm39) missense probably benign 0.01
R7470:Igsf3 UTSW 3 101,358,391 (GRCm39) missense possibly damaging 0.67
R7707:Igsf3 UTSW 3 101,367,238 (GRCm39) missense probably benign 0.00
R7719:Igsf3 UTSW 3 101,342,857 (GRCm39) missense probably damaging 1.00
R7739:Igsf3 UTSW 3 101,342,847 (GRCm39) missense probably damaging 1.00
R8115:Igsf3 UTSW 3 101,362,595 (GRCm39) missense probably benign 0.01
R8128:Igsf3 UTSW 3 101,346,947 (GRCm39) missense probably damaging 1.00
R8221:Igsf3 UTSW 3 101,347,038 (GRCm39) missense probably damaging 1.00
R8716:Igsf3 UTSW 3 101,334,739 (GRCm39) missense probably damaging 1.00
R8730:Igsf3 UTSW 3 101,334,532 (GRCm39) missense probably benign 0.00
R9401:Igsf3 UTSW 3 101,333,075 (GRCm39) missense probably damaging 1.00
R9449:Igsf3 UTSW 3 101,358,322 (GRCm39) missense probably damaging 1.00
R9483:Igsf3 UTSW 3 101,346,904 (GRCm39) missense probably damaging 1.00
R9483:Igsf3 UTSW 3 101,346,817 (GRCm39) missense probably damaging 0.98
R9575:Igsf3 UTSW 3 101,338,625 (GRCm39) missense probably damaging 1.00
R9782:Igsf3 UTSW 3 101,338,612 (GRCm39) missense probably benign 0.03
X0027:Igsf3 UTSW 3 101,342,961 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACCGCCGCAGCAAT -3'
(R):5'- ACTCCCCTCTTCCAGGCCAG -3'

Sequencing Primer
(F):5'- TATGGAGGCATCCAGATGGAG -3'
(R):5'- cccatcttttcattcttccacc -3'
Posted On 2013-04-11