Incidental Mutation 'R1466:Zzef1'
ID 201211
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms C130099L13Rik, 8430405D05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1466 (G1)
Quality Score 198
Status Not validated
Chromosome 11
Chromosomal Location 72796226-72927120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 72924679 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 2942 (P2942S)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069395
AA Change: P2880S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: P2880S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152481
Predicted Effect probably damaging
Transcript: ENSMUST00000172220
AA Change: P2913S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: P2913S

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207107
AA Change: P2942S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110012J17Rik T A 17: 66,380,435 D492V probably damaging Het
Abca13 T C 11: 9,570,536 probably benign Het
Abcg8 G C 17: 84,686,727 probably benign Het
Abhd15 C T 11: 77,515,410 A71V probably damaging Het
AC167973.1 A T 9: 43,265,352 noncoding transcript Het
Adamts12 T C 15: 11,311,359 F1234S probably benign Het
Ahnak A G 19: 9,015,875 D4841G probably damaging Het
Akap13 T C 7: 75,729,049 S2095P possibly damaging Het
Ampd2 T C 3: 108,080,337 probably null Het
Arhgef17 G T 7: 100,929,659 P694Q possibly damaging Het
Arrdc1 T C 2: 24,925,795 I398V probably benign Het
Ash1l T C 3: 89,052,065 Y2250H probably damaging Het
Aspg A G 12: 112,121,852 N385D probably benign Het
Atxn3 G A 12: 101,926,499 R319C possibly damaging Het
BC005561 T A 5: 104,518,257 I215N probably damaging Het
Brca2 G A 5: 150,552,258 A2478T probably damaging Het
Btrc T A 19: 45,513,382 probably benign Het
C1s1 C T 6: 124,531,131 C633Y probably damaging Het
C8g C T 2: 25,500,216 A6T probably benign Het
Capza2 T C 6: 17,657,159 probably benign Het
Cbl A T 9: 44,154,244 V706E probably benign Het
Ccdc84 A T 9: 44,413,680 probably benign Het
Cfhr1 C T 1: 139,557,574 E45K probably benign Het
Chd7 G A 4: 8,840,561 probably null Het
Chek1 G T 9: 36,725,857 A2E probably damaging Het
Clcn2 G A 16: 20,712,552 probably benign Het
Cndp2 G A 18: 84,677,315 probably benign Het
Cntnap1 C A 11: 101,180,360 F366L probably damaging Het
Col5a1 G T 2: 28,003,846 probably benign Het
Corin C T 5: 72,302,790 probably null Het
Crb2 T C 2: 37,783,388 Y99H probably damaging Het
Csf3r T A 4: 126,031,932 probably benign Het
Ctdspl2 G A 2: 122,003,929 R332K probably benign Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cym G A 3: 107,213,458 T277I probably damaging Het
Cyp2d11 C T 15: 82,391,735 C215Y probably benign Het
Dido1 G A 2: 180,662,328 P1261L probably damaging Het
Dnah10 T A 5: 124,763,096 Y1265N probably benign Het
Dtx3l G A 16: 35,932,728 L503F probably damaging Het
Eda T A X: 100,392,392 probably benign Homo
Efhb A G 17: 53,437,178 F462L probably damaging Het
Enpep T A 3: 129,319,448 T203S probably damaging Het
Exd1 G A 2: 119,520,734 probably benign Het
Fam184b G A 5: 45,580,509 probably benign Het
Fam20b T C 1: 156,686,188 probably benign Het
Fat3 A C 9: 16,375,482 V915G probably damaging Het
Fbln7 A G 2: 128,877,429 T49A probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fgf14 T A 14: 124,676,539 K60M probably benign Het
Galnt4 A G 10: 99,108,709 R99G probably benign Het
Gimap4 C A 6: 48,691,282 Q196K probably benign Het
Glcci1 C T 6: 8,537,964 T6I probably damaging Het
Gm10110 A T 14: 89,898,075 noncoding transcript Het
Gm4884 A G 7: 41,043,128 K174E probably damaging Het
Gm6583 C T 5: 112,354,764 G358D probably benign Het
Grip2 A T 6: 91,788,443 D19E probably damaging Het
Grk4 T C 5: 34,694,750 S113P probably benign Het
Hectd3 G A 4: 116,996,566 E220K probably damaging Het
Helz2 G A 2: 181,236,297 P903S probably damaging Het
Hydin T A 8: 110,532,953 V2519E possibly damaging Het
Igf2r A T 17: 12,717,269 probably benign Het
Ints11 G A 4: 155,888,110 probably null Het
Kif1a A G 1: 93,054,929 W718R possibly damaging Het
Kif1b A T 4: 149,223,252 Y839N probably damaging Het
Kif20b T A 19: 34,950,599 V1047D probably benign Het
Klhl23 T C 2: 69,833,888 I527T probably damaging Het
Klra10 T A 6: 130,279,315 R125S probably damaging Het
Klra10 T C 6: 130,279,431 N87D probably damaging Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lcn4 G A 2: 26,668,576 P166L probably damaging Het
Letmd1 T A 15: 100,472,542 probably null Het
Lrrc27 A G 7: 139,230,308 probably benign Het
Map4k2 G T 19: 6,341,917 W87L probably damaging Het
Mccc1 A G 3: 35,974,286 V457A probably benign Het
Mdn1 T A 4: 32,730,788 S2886T probably benign Het
Mgat4a A T 1: 37,464,406 probably benign Het
Mmp1b A T 9: 7,384,779 probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mrpl24 T A 3: 87,921,928 Y21* probably null Het
Mrps35 C T 6: 147,055,984 T169M probably damaging Het
Muc2 A G 7: 141,748,974 Y457C probably damaging Het
Muc4 G A 16: 32,753,595 G1157D probably benign Het
Myg1 T A 15: 102,337,390 L275Q probably damaging Het
Naga T A 15: 82,334,788 M237L probably null Het
Nek1 C T 8: 61,125,136 probably benign Het
Oc90 T A 15: 65,897,720 Y96F probably damaging Het
Olfr1029 T A 2: 85,975,995 F251I probably damaging Het
Olfr103 A T 17: 37,336,956 L92H probably benign Het
Olfr1253 C T 2: 89,752,267 C187Y probably damaging Het
Olfr46 A G 7: 140,610,969 I268V probably benign Het
Olfr522 A G 7: 140,162,203 V249A probably damaging Het
Orc4 A T 2: 48,909,494 C324S possibly damaging Het
Pald1 T C 10: 61,348,525 probably benign Het
Paox A G 7: 140,129,281 probably benign Het
Pcdh10 T G 3: 45,379,974 L241R probably damaging Het
Pdzrn4 T C 15: 92,770,537 S857P probably benign Het
Plec C T 15: 76,185,908 E1000K possibly damaging Het
Plvap A T 8: 71,508,481 V149D probably benign Het
Ppef1 C A X: 160,625,674 probably null Homo
Prkaa1 C A 15: 5,178,798 P507T probably benign Het
Psmd2 A G 16: 20,657,965 probably benign Het
Ptch1 A G 13: 63,524,969 Y804H probably benign Het
R3hdm2 A G 10: 127,476,690 I434V probably benign Het
Rbm28 G A 6: 29,155,017 probably benign Het
Rfx5 T A 3: 94,956,303 Y88N probably damaging Het
Rnase2b A T 14: 51,162,839 K126* probably null Het
Rpl3l A G 17: 24,730,871 I15V probably benign Het
Saal1 G T 7: 46,702,545 probably null Het
Sbpl A C 17: 23,953,254 D230E unknown Het
Scn10a T C 9: 119,666,490 Y322C probably damaging Het
Sec16a A T 2: 26,431,157 Y1308N probably damaging Het
Sis A T 3: 72,932,060 D824E possibly damaging Het
Slc25a36 A G 9: 97,080,355 F194L probably damaging Het
Slc27a4 T A 2: 29,811,190 V331E probably damaging Het
Slc7a11 G T 3: 50,381,073 probably null Het
Slco4c1 A T 1: 96,841,172 S322T probably damaging Het
Smarcc2 A T 10: 128,474,245 T376S probably damaging Het
Srebf1 C T 11: 60,200,702 R999H probably benign Het
St3gal3 A C 4: 118,107,662 M1R probably null Het
Syp A T X: 7,648,705 probably benign Homo
Tas1r2 A G 4: 139,669,411 D687G probably damaging Het
Tekt4 A T 17: 25,472,074 Q118L probably benign Het
Tph2 T C 10: 115,079,695 N480S probably benign Het
Tsc2 A T 17: 24,608,973 M839K probably damaging Het
Ttc22 T C 4: 106,622,780 F77S probably damaging Het
Uaca C T 9: 60,854,321 A205V possibly damaging Het
Ubp1 T G 9: 113,944,835 probably benign Het
Uhmk1 A T 1: 170,208,653 probably null Het
Usp17lc A G 7: 103,418,941 H481R possibly damaging Het
Vwa3a A G 7: 120,768,165 Y181C probably damaging Het
Wdr26 C T 1: 181,185,934 probably benign Het
Wfikkn2 G A 11: 94,238,895 T140I probably damaging Het
Zfp704 G T 3: 9,447,348 T288N possibly damaging Het
Zfp93 T C 7: 24,276,096 V502A probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72863989 missense probably benign 0.00
R8885:Zzef1 UTSW 11 72796576 missense probably benign 0.00
R8972:Zzef1 UTSW 11 72900673 missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72875177 missense probably benign 0.00
R9053:Zzef1 UTSW 11 72922476 missense probably benign
R9108:Zzef1 UTSW 11 72899778 missense probably benign 0.11
R9121:Zzef1 UTSW 11 72866120 nonsense probably null
R9253:Zzef1 UTSW 11 72848637 splice site probably benign
R9370:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72864827 missense possibly damaging 0.86
R9467:Zzef1 UTSW 11 72916425 missense probably damaging 1.00
R9468:Zzef1 UTSW 11 72923183 critical splice donor site probably null
R9563:Zzef1 UTSW 11 72874906 missense probably damaging 1.00
R9647:Zzef1 UTSW 11 72869825 missense probably benign 0.01
R9667:Zzef1 UTSW 11 72867960 missense probably benign
R9742:Zzef1 UTSW 11 72858353 missense probably benign
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCAGCAACTAGACTGCTACCAC -3'
(R):5'- CAGAATCCTTTCAGAGACGGCTTCC -3'

Sequencing Primer
(F):5'- CATGGTTGTTTTATTACTTACCCAGG -3'
(R):5'- GAGCCACTCTACACTGCTGTG -3'
Posted On 2014-05-23