Incidental Mutation 'R0033:Gm43302'
ID201263
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Namepredicted gene 43302
Synonyms
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0033 (G1)
Quality Score34
Status Validated
Chromosome5
Chromosomal Location105214907-105293695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105276844 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 310 (D310G)
Ref Sequence ENSEMBL: ENSMUSP00000142518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
AA Change: D310G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: D310G

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196520
AA Change: D310G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: D310G

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199944
Predicted Effect probably benign
Transcript: ENSMUST00000200045
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Gm43302 UTSW 5 105290900 missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105280489 missense probably benign
R1400:Gm43302 UTSW 5 105274756 missense probably damaging 1.00
R1421:Gm43302 UTSW 5 105217349 missense probably benign
R1539:Gm43302 UTSW 5 105274769 missense probably benign 0.02
R1774:Gm43302 UTSW 5 105275794 missense probably benign 0.01
R1842:Gm43302 UTSW 5 105277736 missense probably benign 0.01
R2011:Gm43302 UTSW 5 105290980 missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105274744 missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105274350 missense probably benign 0.12
R3687:Gm43302 UTSW 5 105280266 missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105217481 missense probably benign 0.00
R5396:Gm43302 UTSW 5 105280089 nonsense probably null
R5668:Gm43302 UTSW 5 105275812 missense probably benign
R5723:Gm43302 UTSW 5 105217486 missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105290959 missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105289028 missense probably benign 0.11
R6225:Gm43302 UTSW 5 105277739 nonsense probably null
R6483:Gm43302 UTSW 5 105275860 missense probably benign 0.01
R6537:Gm43302 UTSW 5 105290995 missense possibly damaging 0.94
R6678:Gm43302 UTSW 5 105290954 missense probably benign 0.14
R6889:Gm43302 UTSW 5 105280138 missense probably benign 0.00
R7163:Gm43302 UTSW 5 105293627 splice site probably null
R7790:Gm43302 UTSW 5 105277825 missense probably benign 0.03
R7893:Gm43302 UTSW 5 105289025 nonsense probably null
R8047:Gm43302 UTSW 5 105274757 missense possibly damaging 0.74
R8350:Gm43302 UTSW 5 105274707 critical splice donor site probably null
RF014:Gm43302 UTSW 5 105274757 missense possibly damaging 0.94
Z1177:Gm43302 UTSW 5 105276796 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAATGCTCCATGAAGACAGCC -3'
(R):5'- AACCACTAAAGCTGATCCCTTCTGC -3'

Sequencing Primer
(F):5'- CATGGCTTCCTTCTCGCAG -3'
(R):5'- CTGAAGGAGGTTTtgtgtgtg -3'
Posted On2014-05-27