Incidental Mutation 'R0033:D430042O09Rik'
ID201268
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 038327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0033 (G1)
Quality Score57
Status Validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125761827 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 103 (V103G)
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223] [ENSMUST00000148701]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069660
AA Change: V129G

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: V129G

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124223
AA Change: V103G

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: V103G

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148701
Meta Mutation Damage Score 0.1106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Uba5 T A 9: 104,054,148 T241S probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 unclassified probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
R7584:D430042O09Rik UTSW 7 125870666 missense probably damaging 0.99
R7629:D430042O09Rik UTSW 7 125795250 missense probably damaging 0.96
R7676:D430042O09Rik UTSW 7 125850377 missense probably benign 0.26
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTGCAGTTTACTCCAGGCAGATG -3'
(R):5'- ATGAGCCCTCAAGAATGAGCATGG -3'

Sequencing Primer
(F):5'- CATATGAATGACCTTGAGCAGC -3'
(R):5'- GAGCATGGGTCTGCTCTTACTATAC -3'
Posted On2014-05-27