Incidental Mutation 'R0033:Uba5'
ID201270
Institutional Source Beutler Lab
Gene Symbol Uba5
Ensembl Gene ENSMUSG00000032557
Gene Nameubiquitin-like modifier activating enzyme 5
SynonymsUbe1dc1, 5730525G14Rik
MMRRC Submission 038327-MU
Accession Numbers

Genbank: NM_025692; MGI: 1913913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0033 (G1)
Quality Score64
Status Validated
Chromosome9
Chromosomal Location104046599-104063134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104054148 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 241 (T241S)
Ref Sequence ENSEMBL: ENSMUSP00000035166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000140768] [ENSMUST00000144195]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
AA Change: T241S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557
AA Change: T241S

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140768
SMART Domains Protein: ENSMUSP00000118734
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 70 101 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144195
SMART Domains Protein: ENSMUSP00000118535
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
Pfam:ThiF 1 119 1.9e-22 PFAM
low complexity region 220 235 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193563
Predicted Effect probably benign
Transcript: ENSMUST00000214222
Meta Mutation Damage Score 0.1912 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 93.3%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die at E12.5. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T C 1: 120,188,064 F110L probably damaging Het
Agr3 C T 12: 35,928,330 T14M possibly damaging Het
Ankib1 A C 5: 3,769,588 D110E possibly damaging Het
Auts2 G C 5: 131,440,093 D571E probably damaging Het
Cacna1d T A 14: 30,105,489 Q993L probably damaging Het
Cdkn3 C A 14: 46,768,872 Y141* probably null Het
Ceacam12 T G 7: 18,069,460 probably benign Het
Celf1 T C 2: 91,001,453 probably benign Het
Col6a3 A G 1: 90,802,245 S1780P probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Ctss G A 3: 95,545,577 probably benign Het
D430042O09Rik T G 7: 125,761,827 V103G possibly damaging Het
Emilin2 G T 17: 71,275,014 T239K probably benign Het
Erp44 T C 4: 48,241,289 probably benign Het
Fbxl4 T C 4: 22,377,017 V151A probably damaging Het
Fer1l4 G A 2: 156,024,106 probably benign Het
Gm12794 A T 4: 101,941,684 Y284F probably benign Het
Gm43302 T C 5: 105,276,844 D310G probably benign Het
Gstk1 A G 6: 42,246,803 probably benign Het
Hapln1 A T 13: 89,601,813 Q159L probably benign Het
Hibch A G 1: 52,905,451 K296R probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kdm7a A T 6: 39,165,197 Y382* probably null Het
Kirrel3 A G 9: 35,000,963 I208V probably benign Het
Klc4 A T 17: 46,635,433 C489S probably damaging Het
Lrrc8a G T 2: 30,255,345 C57F probably damaging Het
Ltbp1 A G 17: 75,276,509 N435D possibly damaging Het
Macc1 T A 12: 119,446,341 N281K probably benign Het
Myo16 A T 8: 10,370,955 Y265F probably damaging Het
Myoc G A 1: 162,648,441 G238E probably damaging Het
Nlrp12 A C 7: 3,240,407 S492A probably damaging Het
Obscn A G 11: 58,994,746 probably benign Het
Olfr1413 A G 1: 92,573,260 T30A probably benign Het
Olfr486 G T 7: 108,171,927 D272E probably benign Het
Oplah T A 15: 76,297,134 Q1202L probably benign Het
Ppargc1b G A 18: 61,307,694 R718W probably damaging Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rnf225 T C 7: 12,928,158 L88P probably damaging Het
Slc12a1 A G 2: 125,214,009 D820G probably benign Het
Slc12a4 G T 8: 105,947,479 probably benign Het
Slx4 C T 16: 3,988,000 A72T probably benign Het
Snrnp200 T C 2: 127,238,063 I1920T probably damaging Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Sv2b A G 7: 75,117,741 F636L probably benign Het
Tdp1 C T 12: 99,935,052 T531I probably benign Het
Thra G A 11: 98,764,352 V353I probably benign Het
Tm7sf2 A G 19: 6,066,422 probably benign Het
Tmx4 A T 2: 134,600,998 probably null Het
Tnfrsf12a A G 17: 23,676,145 probably null Het
Trav6n-5 T A 14: 53,104,911 M14K probably benign Het
Ttn T A 2: 76,742,280 I26090F probably damaging Het
Tut1 G T 19: 8,962,759 R369L probably benign Het
Unc13d T C 11: 116,069,165 T597A probably benign Het
Vmn1r58 A T 7: 5,410,388 I281K probably damaging Het
Vmn1r59 A G 7: 5,454,434 V109A probably benign Het
Xdh T A 17: 73,907,632 M773L probably benign Het
Zfp64 A T 2: 168,925,715 I659N possibly damaging Het
Other mutations in Uba5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Uba5 APN 9 104054060 splice site probably benign
IGL02891:Uba5 APN 9 104054193 splice site probably benign
IGL03182:Uba5 APN 9 104054129 missense possibly damaging 0.78
3-1:Uba5 UTSW 9 104060392 critical splice donor site probably null
PIT4810001:Uba5 UTSW 9 104055197 missense probably damaging 1.00
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0745:Uba5 UTSW 9 104049511 unclassified probably benign
R1018:Uba5 UTSW 9 104049903 missense probably benign 0.00
R1163:Uba5 UTSW 9 104055826 missense possibly damaging 0.70
R1771:Uba5 UTSW 9 104049908 missense probably damaging 1.00
R2164:Uba5 UTSW 9 104060243 missense probably damaging 1.00
R3916:Uba5 UTSW 9 104054190 missense probably damaging 1.00
R5072:Uba5 UTSW 9 104054427 missense probably damaging 1.00
R5177:Uba5 UTSW 9 104049298 missense probably benign
R5563:Uba5 UTSW 9 104049247 missense probably benign 0.18
R6606:Uba5 UTSW 9 104055221 missense probably damaging 1.00
R7258:Uba5 UTSW 9 104062933 missense unknown
R7337:Uba5 UTSW 9 104055255 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AATCTAAGCCCTGGTCTCCACCTAC -3'
(R):5'- TGTCTGCCATTCCAAGGAGCCAAG -3'

Sequencing Primer
(F):5'- GCATTCTCATAATAGAGCCTCTGG -3'
(R):5'- CCAAGGAGCCAAGGGGTG -3'
Posted On2014-05-27