Incidental Mutation 'R0048:Wdr76'
ID201279
Institutional Source Beutler Lab
Gene Symbol Wdr76
Ensembl Gene ENSMUSG00000027242
Gene NameWD repeat domain 76
Synonyms5830411K18Rik
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0048 (G1)
Quality Score56
Status Validated
Chromosome2
Chromosomal Location121506723-121544860 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 121535419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028676] [ENSMUST00000099473] [ENSMUST00000110602] [ENSMUST00000110603]
Predicted Effect probably benign
Transcript: ENSMUST00000028676
SMART Domains Protein: ENSMUSP00000028676
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099473
SMART Domains Protein: ENSMUSP00000097072
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 109 125 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
WD40 221 260 8.59e-1 SMART
WD40 265 305 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110602
SMART Domains Protein: ENSMUSP00000106232
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
low complexity region 93 109 N/A INTRINSIC
low complexity region 137 154 N/A INTRINSIC
WD40 205 244 8.59e-1 SMART
WD40 249 289 1.63e-4 SMART
WD40 292 331 1.98e1 SMART
WD40 336 375 4.75e1 SMART
WD40 383 423 9.24e-4 SMART
low complexity region 424 435 N/A INTRINSIC
WD40 479 520 2.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110603
SMART Domains Protein: ENSMUSP00000106234
Gene: ENSMUSG00000027242

DomainStartEndE-ValueType
low complexity region 56 94 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 138 147 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
WD40 303 342 8.59e-1 SMART
WD40 347 387 1.63e-4 SMART
WD40 390 429 1.98e1 SMART
WD40 434 473 4.75e1 SMART
WD40 481 521 9.24e-4 SMART
low complexity region 522 533 N/A INTRINSIC
WD40 577 618 2.28e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132373
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Wdr76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Wdr76 APN 2 121535497 missense probably benign 0.11
IGL01930:Wdr76 APN 2 121510822 missense possibly damaging 0.82
IGL03166:Wdr76 APN 2 121534306 missense possibly damaging 0.76
IGL03242:Wdr76 APN 2 121542470 missense probably damaging 0.98
R0048:Wdr76 UTSW 2 121535419 splice site probably benign
R0049:Wdr76 UTSW 2 121519451 missense probably damaging 1.00
R1575:Wdr76 UTSW 2 121528921 missense probably damaging 1.00
R4400:Wdr76 UTSW 2 121528833 missense probably damaging 1.00
R4825:Wdr76 UTSW 2 121542494 missense probably benign 0.25
R5622:Wdr76 UTSW 2 121517735 missense probably damaging 1.00
R5895:Wdr76 UTSW 2 121528842 missense probably damaging 1.00
R6349:Wdr76 UTSW 2 121534231 missense possibly damaging 0.45
R7229:Wdr76 UTSW 2 121528920 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGGAGAAACACACATCTCTGCC -3'
(R):5'- CAGTCAGCACATGTAGTCACCACTC -3'

Sequencing Primer
(F):5'- AGCTGTGTGTGACCTATAACC -3'
(R):5'- ATGTAGTCACCACTCTGTTACCAG -3'
Posted On2014-05-28