Incidental Mutation 'R0048:Ptgfr'
ID 201283
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Name prostaglandin F receptor
Synonyms FP, PGF
MMRRC Submission 038342-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0048 (G1)
Quality Score 76
Status Validated
Chromosome 3
Chromosomal Location 151504247-151543165 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 151540728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 260 (V260A)
Ref Sequence ENSEMBL: ENSMUSP00000101732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
AlphaFold P43117
Predicted Effect possibly damaging
Transcript: ENSMUST00000029670
AA Change: V260A

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: V260A

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106126
AA Change: V260A

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: V260A

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197392
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,140,563 (GRCm39) I299T probably benign Het
Ankrd12 A G 17: 66,291,798 (GRCm39) S1212P probably damaging Het
Ankrd50 A G 3: 38,537,198 (GRCm39) S52P probably benign Het
Brca1 A G 11: 101,415,803 (GRCm39) V777A possibly damaging Het
Cblif G A 19: 11,727,120 (GRCm39) V110M possibly damaging Het
Dppa2 A G 16: 48,137,761 (GRCm39) M248V probably benign Het
Fat2 G T 11: 55,200,865 (GRCm39) H736Q probably benign Het
Fgfr2 A T 7: 129,782,218 (GRCm39) probably benign Het
Hmcn2 T C 2: 31,318,249 (GRCm39) S3865P possibly damaging Het
Iqgap3 A T 3: 88,023,256 (GRCm39) T516S probably benign Het
Itpr2 T C 6: 146,133,789 (GRCm39) probably null Het
Lrrfip1 C T 1: 91,021,369 (GRCm39) probably benign Het
Mfsd12 G A 10: 81,198,648 (GRCm39) V380I possibly damaging Het
Mroh9 G A 1: 162,890,056 (GRCm39) T227M probably damaging Het
Mtor C T 4: 148,623,338 (GRCm39) Q2063* probably null Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Or13c3 C A 4: 52,856,196 (GRCm39) A106S probably damaging Het
Raph1 T C 1: 60,539,764 (GRCm39) K423E probably benign Het
Rbm27 A G 18: 42,431,529 (GRCm39) D112G probably benign Het
Ryr2 T C 13: 11,610,670 (GRCm39) E4052G probably damaging Het
Sart3 G T 5: 113,893,458 (GRCm39) D346E possibly damaging Het
Siglec1 T C 2: 130,915,317 (GRCm39) T1425A possibly damaging Het
Snx25 A T 8: 46,558,146 (GRCm39) probably benign Het
Son T A 16: 91,455,865 (GRCm39) H1537Q possibly damaging Het
Tgfb1 T A 7: 25,393,779 (GRCm39) probably benign Het
Umodl1 A T 17: 31,187,451 (GRCm39) N172Y probably damaging Het
Urah C T 7: 140,416,665 (GRCm39) T46I probably damaging Het
Usp8 C T 2: 126,579,809 (GRCm39) P353L probably damaging Het
Vamp2 A G 11: 68,980,585 (GRCm39) D51G possibly damaging Het
Vmn1r67 G A 7: 10,180,793 (GRCm39) G19E probably damaging Het
Wdr76 C T 2: 121,365,900 (GRCm39) probably benign Het
Wwox C A 8: 115,166,570 (GRCm39) P20Q probably damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151,541,323 (GRCm39) missense probably benign 0.43
IGL02085:Ptgfr APN 3 151,541,437 (GRCm39) missense probably benign 0.00
IGL02110:Ptgfr APN 3 151,541,097 (GRCm39) missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151,540,963 (GRCm39) missense probably benign 0.00
IGL03263:Ptgfr APN 3 151,541,500 (GRCm39) missense probably benign 0.00
R0048:Ptgfr UTSW 3 151,540,728 (GRCm39) missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151,540,839 (GRCm39) missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151,540,839 (GRCm39) missense probably damaging 1.00
R0633:Ptgfr UTSW 3 151,507,400 (GRCm39) missense probably benign 0.00
R1614:Ptgfr UTSW 3 151,507,416 (GRCm39) missense probably benign 0.44
R1930:Ptgfr UTSW 3 151,540,831 (GRCm39) missense probably benign 0.16
R1931:Ptgfr UTSW 3 151,540,831 (GRCm39) missense probably benign 0.16
R1989:Ptgfr UTSW 3 151,540,976 (GRCm39) nonsense probably null
R4596:Ptgfr UTSW 3 151,507,430 (GRCm39) missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151,540,738 (GRCm39) missense probably damaging 0.96
R6295:Ptgfr UTSW 3 151,540,926 (GRCm39) missense probably benign 0.00
R6907:Ptgfr UTSW 3 151,540,938 (GRCm39) missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151,541,178 (GRCm39) missense possibly damaging 0.74
R7320:Ptgfr UTSW 3 151,541,034 (GRCm39) missense probably benign 0.22
R8205:Ptgfr UTSW 3 151,541,418 (GRCm39) missense probably benign 0.04
R8420:Ptgfr UTSW 3 151,541,053 (GRCm39) missense possibly damaging 0.49
R9049:Ptgfr UTSW 3 151,541,404 (GRCm39) missense probably benign 0.24
R9352:Ptgfr UTSW 3 151,541,160 (GRCm39) missense probably damaging 1.00
R9537:Ptgfr UTSW 3 151,541,445 (GRCm39) missense possibly damaging 0.91
Z1176:Ptgfr UTSW 3 151,541,278 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAGAGCTGAGCACTGAAGTC -3'
(R):5'- GCGTCCAGAACCTGGTGTTTCTAC -3'

Sequencing Primer
(F):5'- CTGAGCACTGAAGTCAGTTTTAGC -3'
(R):5'- CTGGTGTTTCTACAACACAGAGC -3'
Posted On 2014-05-28