Incidental Mutation 'R0048:Olfr273'
ID201284
Institutional Source Beutler Lab
Gene Symbol Olfr273
Ensembl Gene ENSMUSG00000049648
Gene Nameolfactory receptor 273
SynonymsGA_x6K02T2N78B-7137430-7138383, MOR262-8
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0048 (G1)
Quality Score23
Status Validated
Chromosome4
Chromosomal Location52852154-52859236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52856196 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 106 (A106S)
Ref Sequence ENSEMBL: ENSMUSP00000103297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051520] [ENSMUST00000107670] [ENSMUST00000215274]
Predicted Effect probably damaging
Transcript: ENSMUST00000051520
AA Change: A106S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052080
Gene: ENSMUSG00000049648
AA Change: A106S

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.3e-55 PFAM
Pfam:7tm_1 41 296 1.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107670
AA Change: A106S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103297
Gene: ENSMUSG00000049648
AA Change: A106S

DomainStartEndE-ValueType
Pfam:7tm_1 41 296 3.2e-37 PFAM
Pfam:7tm_4 139 289 4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215274
AA Change: A106S

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.2687 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Olfr273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Olfr273 APN 4 52856144 missense probably damaging 1.00
R0048:Olfr273 UTSW 4 52856196 missense probably damaging 1.00
R0826:Olfr273 UTSW 4 52855566 missense probably benign
R0831:Olfr273 UTSW 4 52855764 missense possibly damaging 0.46
R1772:Olfr273 UTSW 4 52855730 missense probably benign 0.30
R1774:Olfr273 UTSW 4 52855674 missense probably benign 0.01
R1861:Olfr273 UTSW 4 52856373 missense probably benign 0.00
R2080:Olfr273 UTSW 4 52855568 missense probably benign 0.20
R2242:Olfr273 UTSW 4 52855769 missense probably damaging 1.00
R3777:Olfr273 UTSW 4 52855636 missense probably damaging 1.00
R4492:Olfr273 UTSW 4 52855764 missense probably benign 0.01
R4748:Olfr273 UTSW 4 52856076 missense possibly damaging 0.95
R4880:Olfr273 UTSW 4 52856411 missense probably damaging 1.00
R4905:Olfr273 UTSW 4 52855613 missense probably damaging 0.99
R5856:Olfr273 UTSW 4 52856516 start gained probably benign
R6585:Olfr273 UTSW 4 52856192 missense possibly damaging 0.84
R6862:Olfr273 UTSW 4 52855695 missense probably benign
R7378:Olfr273 UTSW 4 52856421 missense probably benign
R7649:Olfr273 UTSW 4 52855692 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCACAACTGAATTGATGCTGCC -3'
(R):5'- GGTCTTGCTGGATACCCAAAGACTG -3'

Sequencing Primer
(F):5'- TTGATGCTGCCAGAGAACC -3'
(R):5'- GCAATGGTGTTCTGATCATAGCAAG -3'
Posted On2014-05-28