Incidental Mutation 'R0048:Urah'
ID201288
Institutional Source Beutler Lab
Gene Symbol Urah
Ensembl Gene ENSMUSG00000025481
Gene Nameurate (5-hydroxyiso-) hydrolase
Synonyms2810420C16Rik, HIU hydrolase, 1190003J15Rik
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0048 (G1)
Quality Score22
Status Validated
Chromosome7
Chromosomal Location140835018-140837966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 140836752 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 46 (T46I)
Ref Sequence ENSEMBL: ENSMUSP00000147522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026554] [ENSMUST00000106050] [ENSMUST00000185612] [ENSMUST00000209690] [ENSMUST00000209978] [ENSMUST00000210916] [ENSMUST00000211372]
Predicted Effect probably damaging
Transcript: ENSMUST00000026554
AA Change: T46I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026554
Gene: ENSMUSG00000025481
AA Change: T46I

DomainStartEndE-ValueType
TR_THY 3 117 3.05e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106050
AA Change: T69I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101665
Gene: ENSMUSG00000025481
AA Change: T69I

DomainStartEndE-ValueType
TR_THY 3 117 3.05e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127986
Predicted Effect probably damaging
Transcript: ENSMUST00000185612
AA Change: T46I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140559
Gene: ENSMUSG00000025481
AA Change: T46I

DomainStartEndE-ValueType
TR_THY 3 117 3.05e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190581
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Predicted Effect probably damaging
Transcript: ENSMUST00000209978
AA Change: T45I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210916
AA Change: T39I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211372
AA Change: T46I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation have an elevated platelet cell number, display hepatomegaly and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Wwox C A 8: 114,439,830 P20Q probably damaging Het
Other mutations in Urah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Urah APN 7 140836886 splice site probably benign
IGL02201:Urah APN 7 140835663 missense probably damaging 0.98
IGL02661:Urah APN 7 140837705 missense probably damaging 0.96
R0048:Urah UTSW 7 140836752 missense probably damaging 1.00
R0254:Urah UTSW 7 140837689 missense probably benign 0.06
R6086:Urah UTSW 7 140836798 missense probably benign 0.03
R6237:Urah UTSW 7 140835705 missense probably damaging 0.98
R6374:Urah UTSW 7 140835211 missense probably benign 0.00
R7544:Urah UTSW 7 140835652 missense probably damaging 1.00
R7581:Urah UTSW 7 140835627 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCTGACCAGCCTGTGAGAAC -3'
(R):5'- AATCAGGGTCCATGTGCTTCACC -3'

Sequencing Primer
(F):5'- CACCAACCTGGAGAGGTTTTATC -3'
(R):5'- ATGTGCTTCACCCACCCTG -3'
Posted On2014-05-28