Incidental Mutation 'R0048:Wwox'
ID 201290
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene Name WW domain-containing oxidoreductase
Synonyms WOX1, 9030416C10Rik, 5330426P09Rik
MMRRC Submission 038342-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.907) question?
Stock # R0048 (G1)
Quality Score 20
Status Validated
Chromosome 8
Chromosomal Location 115166395-116079447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115166570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 20 (P20Q)
Ref Sequence ENSEMBL: ENSMUSP00000125626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109107] [ENSMUST00000109108] [ENSMUST00000160862]
AlphaFold Q91WL8
Predicted Effect probably damaging
Transcript: ENSMUST00000004756
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109107
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104735
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109108
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160005
Predicted Effect probably damaging
Transcript: ENSMUST00000160862
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Meta Mutation Damage Score 0.5072 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,140,563 (GRCm39) I299T probably benign Het
Ankrd12 A G 17: 66,291,798 (GRCm39) S1212P probably damaging Het
Ankrd50 A G 3: 38,537,198 (GRCm39) S52P probably benign Het
Brca1 A G 11: 101,415,803 (GRCm39) V777A possibly damaging Het
Cblif G A 19: 11,727,120 (GRCm39) V110M possibly damaging Het
Dppa2 A G 16: 48,137,761 (GRCm39) M248V probably benign Het
Fat2 G T 11: 55,200,865 (GRCm39) H736Q probably benign Het
Fgfr2 A T 7: 129,782,218 (GRCm39) probably benign Het
Hmcn2 T C 2: 31,318,249 (GRCm39) S3865P possibly damaging Het
Iqgap3 A T 3: 88,023,256 (GRCm39) T516S probably benign Het
Itpr2 T C 6: 146,133,789 (GRCm39) probably null Het
Lrrfip1 C T 1: 91,021,369 (GRCm39) probably benign Het
Mfsd12 G A 10: 81,198,648 (GRCm39) V380I possibly damaging Het
Mroh9 G A 1: 162,890,056 (GRCm39) T227M probably damaging Het
Mtor C T 4: 148,623,338 (GRCm39) Q2063* probably null Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Or13c3 C A 4: 52,856,196 (GRCm39) A106S probably damaging Het
Ptgfr A G 3: 151,540,728 (GRCm39) V260A possibly damaging Het
Raph1 T C 1: 60,539,764 (GRCm39) K423E probably benign Het
Rbm27 A G 18: 42,431,529 (GRCm39) D112G probably benign Het
Ryr2 T C 13: 11,610,670 (GRCm39) E4052G probably damaging Het
Sart3 G T 5: 113,893,458 (GRCm39) D346E possibly damaging Het
Siglec1 T C 2: 130,915,317 (GRCm39) T1425A possibly damaging Het
Snx25 A T 8: 46,558,146 (GRCm39) probably benign Het
Son T A 16: 91,455,865 (GRCm39) H1537Q possibly damaging Het
Tgfb1 T A 7: 25,393,779 (GRCm39) probably benign Het
Umodl1 A T 17: 31,187,451 (GRCm39) N172Y probably damaging Het
Urah C T 7: 140,416,665 (GRCm39) T46I probably damaging Het
Usp8 C T 2: 126,579,809 (GRCm39) P353L probably damaging Het
Vamp2 A G 11: 68,980,585 (GRCm39) D51G possibly damaging Het
Vmn1r67 G A 7: 10,180,793 (GRCm39) G19E probably damaging Het
Wdr76 C T 2: 121,365,900 (GRCm39) probably benign Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 115,172,118 (GRCm39) nonsense probably null
IGL02156:Wwox APN 8 115,174,899 (GRCm39) critical splice acceptor site probably null
IGL02267:Wwox APN 8 115,438,805 (GRCm39) missense probably benign 0.23
IGL02346:Wwox APN 8 115,438,858 (GRCm39) missense probably benign 0.11
IGL02350:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02357:Wwox APN 8 115,438,882 (GRCm39) missense possibly damaging 0.81
IGL02586:Wwox APN 8 115,438,947 (GRCm39) missense possibly damaging 0.59
IGL02701:Wwox APN 8 115,433,108 (GRCm39) missense probably damaging 1.00
IGL02743:Wwox APN 8 116,078,443 (GRCm39) missense probably damaging 1.00
IGL02804:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
IGL02805:Wwox APN 8 115,438,753 (GRCm39) missense probably damaging 1.00
R0140:Wwox UTSW 8 115,433,027 (GRCm39) missense probably damaging 1.00
R0390:Wwox UTSW 8 115,433,018 (GRCm39) missense probably benign 0.08
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1146:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R1193:Wwox UTSW 8 115,406,614 (GRCm39) missense probably benign
R1520:Wwox UTSW 8 115,438,873 (GRCm39) missense probably benign 0.36
R1552:Wwox UTSW 8 115,172,090 (GRCm39) nonsense probably null
R1628:Wwox UTSW 8 115,174,973 (GRCm39) missense probably benign
R1639:Wwox UTSW 8 115,172,118 (GRCm39) nonsense probably null
R3778:Wwox UTSW 8 115,601,347 (GRCm39) missense probably benign 0.00
R3967:Wwox UTSW 8 115,215,673 (GRCm39) missense probably damaging 1.00
R4077:Wwox UTSW 8 115,166,481 (GRCm39) utr 5 prime probably benign
R4876:Wwox UTSW 8 115,174,988 (GRCm39) missense probably damaging 1.00
R4936:Wwox UTSW 8 115,433,098 (GRCm39) missense probably benign 0.00
R5868:Wwox UTSW 8 115,406,586 (GRCm39) missense probably benign
R5988:Wwox UTSW 8 115,433,081 (GRCm39) missense probably benign 0.06
R6272:Wwox UTSW 8 115,215,692 (GRCm39) missense probably damaging 1.00
R7043:Wwox UTSW 8 115,406,578 (GRCm39) missense probably damaging 0.97
R7348:Wwox UTSW 8 115,199,392 (GRCm39) missense probably benign 0.00
R7815:Wwox UTSW 8 115,438,776 (GRCm39) missense probably damaging 1.00
R8119:Wwox UTSW 8 115,433,108 (GRCm39) missense probably damaging 1.00
R8324:Wwox UTSW 8 115,215,745 (GRCm39) critical splice donor site probably null
R8544:Wwox UTSW 8 115,215,646 (GRCm39) missense probably benign 0.08
R9065:Wwox UTSW 8 115,215,682 (GRCm39) missense probably benign 0.05
R9183:Wwox UTSW 8 115,433,110 (GRCm39) missense probably damaging 1.00
R9187:Wwox UTSW 8 115,438,978 (GRCm39) missense probably damaging 0.97
R9525:Wwox UTSW 8 115,433,105 (GRCm39) missense probably benign 0.11
R9640:Wwox UTSW 8 115,166,540 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATGATGACTGGGTAAGCACGCC -3'
(R):5'- CAAGACTTCCCTGGGAAACCACTG -3'

Sequencing Primer
(F):5'- GGCTGAGGAAGCTTATTCCAG -3'
(R):5'- AATACAGATTGCTGGGCCTC -3'
Posted On 2014-05-28