Incidental Mutation 'R0048:Wwox'
ID201290
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene NameWW domain-containing oxidoreductase
Synonyms9030416C10Rik, WOX1, 5330426P09Rik
MMRRC Submission 038342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R0048 (G1)
Quality Score20
Status Validated
Chromosome8
Chromosomal Location114439655-115352708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 114439830 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 20 (P20Q)
Ref Sequence ENSEMBL: ENSMUSP00000125626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109107] [ENSMUST00000109108] [ENSMUST00000160862]
Predicted Effect probably damaging
Transcript: ENSMUST00000004756
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109107
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104735
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109108
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160005
Predicted Effect probably damaging
Transcript: ENSMUST00000160862
AA Change: P20Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: P20Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Meta Mutation Damage Score 0.5072 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A G 1: 25,101,482 I299T probably benign Het
Ankrd12 A G 17: 65,984,803 S1212P probably damaging Het
Ankrd50 A G 3: 38,483,049 S52P probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Dppa2 A G 16: 48,317,398 M248V probably benign Het
Fat2 G T 11: 55,310,039 H736Q probably benign Het
Fgfr2 A T 7: 130,180,488 probably benign Het
Gif G A 19: 11,749,756 V110M possibly damaging Het
Hmcn2 T C 2: 31,428,237 S3865P possibly damaging Het
Iqgap3 A T 3: 88,115,949 T516S probably benign Het
Itpr2 T C 6: 146,232,291 probably null Het
Lrrfip1 C T 1: 91,093,647 probably benign Het
Mfsd12 G A 10: 81,362,814 V380I possibly damaging Het
Mroh9 G A 1: 163,062,487 T227M probably damaging Het
Mtor C T 4: 148,538,881 Q2063* probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Olfr273 C A 4: 52,856,196 A106S probably damaging Het
Ptgfr A G 3: 151,835,091 V260A possibly damaging Het
Raph1 T C 1: 60,500,605 K423E probably benign Het
Rbm27 A G 18: 42,298,464 D112G probably benign Het
Ryr2 T C 13: 11,595,784 E4052G probably damaging Het
Sart3 G T 5: 113,755,397 D346E possibly damaging Het
Siglec1 T C 2: 131,073,397 T1425A possibly damaging Het
Snx25 A T 8: 46,105,109 probably benign Het
Son T A 16: 91,658,977 H1537Q possibly damaging Het
Tgfb1 T A 7: 25,694,354 probably benign Het
Umodl1 A T 17: 30,968,477 N172Y probably damaging Het
Urah C T 7: 140,836,752 T46I probably damaging Het
Usp8 C T 2: 126,737,889 P353L probably damaging Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r67 G A 7: 10,446,866 G19E probably damaging Het
Wdr76 C T 2: 121,535,419 probably benign Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 114445378 nonsense probably null
IGL02156:Wwox APN 8 114448159 critical splice acceptor site probably null
IGL02267:Wwox APN 8 114712065 missense probably benign 0.23
IGL02346:Wwox APN 8 114712118 missense probably benign 0.11
IGL02350:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02357:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02586:Wwox APN 8 114712207 missense possibly damaging 0.59
IGL02701:Wwox APN 8 114706368 missense probably damaging 1.00
IGL02743:Wwox APN 8 115351704 missense probably damaging 1.00
IGL02804:Wwox APN 8 114712013 missense probably damaging 1.00
IGL02805:Wwox APN 8 114712013 missense probably damaging 1.00
R0140:Wwox UTSW 8 114706287 missense probably damaging 1.00
R0390:Wwox UTSW 8 114706278 missense probably benign 0.08
R1146:Wwox UTSW 8 114712036 missense probably damaging 1.00
R1146:Wwox UTSW 8 114712036 missense probably damaging 1.00
R1193:Wwox UTSW 8 114679874 missense probably benign
R1520:Wwox UTSW 8 114712133 missense probably benign 0.36
R1552:Wwox UTSW 8 114445350 nonsense probably null
R1628:Wwox UTSW 8 114448233 missense probably benign
R1639:Wwox UTSW 8 114445378 nonsense probably null
R3778:Wwox UTSW 8 114874607 missense probably benign 0.00
R3967:Wwox UTSW 8 114488933 missense probably damaging 1.00
R4077:Wwox UTSW 8 114439741 utr 5 prime probably benign
R4876:Wwox UTSW 8 114448248 missense probably damaging 1.00
R4936:Wwox UTSW 8 114706358 missense probably benign 0.00
R5868:Wwox UTSW 8 114679846 missense probably benign
R5988:Wwox UTSW 8 114706341 missense probably benign 0.06
R6272:Wwox UTSW 8 114488952 missense probably damaging 1.00
R7043:Wwox UTSW 8 114679838 missense probably damaging 0.97
R7348:Wwox UTSW 8 114472652 missense probably benign 0.00
R7815:Wwox UTSW 8 114712036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGACTGGGTAAGCACGCC -3'
(R):5'- CAAGACTTCCCTGGGAAACCACTG -3'

Sequencing Primer
(F):5'- GGCTGAGGAAGCTTATTCCAG -3'
(R):5'- AATACAGATTGCTGGGCCTC -3'
Posted On2014-05-28