Incidental Mutation 'R0005:Zfp335'
ID201299
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0005 (G1)
Quality Score22
Status Validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164909302 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 115 (S115C)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041361
AA Change: S115C

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: S115C

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129364
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142338
Predicted Effect possibly damaging
Transcript: ENSMUST00000183830
AA Change: S115C

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834
AA Change: S115C

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7296:Zfp335 UTSW 2 164900132 missense probably damaging 0.99
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
R7504:Zfp335 UTSW 2 164909418 missense probably benign 0.27
R7560:Zfp335 UTSW 2 164895992 missense probably damaging 1.00
R7637:Zfp335 UTSW 2 164892539 critical splice donor site probably null
R8064:Zfp335 UTSW 2 164907700 missense not run
RF031:Zfp335 UTSW 2 164907463 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCACTGTGACATCCTGGCATC -3'
(R):5'- CTGGGCCTCTGTAAGGCTGAAATG -3'

Sequencing Primer
(F):5'- GTGACATCCTGGCATCATACTAAG -3'
(R):5'- GGTATCTACAGGCTGCTCTGTC -3'
Posted On2014-05-28