Incidental Mutation 'R0005:Wdr48'
ID201306
Institutional Source Beutler Lab
Gene Symbol Wdr48
Ensembl Gene ENSMUSG00000032512
Gene NameWD repeat domain 48
SynonymsUaf1, 8430408H12Rik
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0005 (G1)
Quality Score72
Status Validated
Chromosome9
Chromosomal Location119894878-119926587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119909434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 53 (D53E)
Ref Sequence ENSEMBL: ENSMUSP00000149793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036561] [ENSMUST00000177637] [ENSMUST00000215167] [ENSMUST00000215307] [ENSMUST00000217472]
Predicted Effect probably benign
Transcript: ENSMUST00000036561
AA Change: D252E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000042509
Gene: ENSMUSG00000032512
AA Change: D252E

DomainStartEndE-ValueType
WD40 14 58 2.88e-1 SMART
WD40 64 103 2.1e-7 SMART
WD40 106 145 1.37e-6 SMART
WD40 157 196 5.39e-5 SMART
WD40 199 238 1.62e-8 SMART
WD40 241 280 4.62e-4 SMART
WD40 350 388 8.84e1 SMART
low complexity region 460 471 N/A INTRINSIC
Pfam:DUF3337 509 673 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213230
Predicted Effect probably benign
Transcript: ENSMUST00000215167
AA Change: D53E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215307
AA Change: D252E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217472
AA Change: D252E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217555
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to interact with ubiquitin specific peptidase 1 (USP1), activating the deubiquitinating activity of USP1 and allowing it to remove the ubiquitin moiety from monoubiquitinated FANCD2. FANCD2 is ubiquitinated in response to DNA damage. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E10.5 with reduced embryonic growth. Mice heterozygous for this allele exhibit reduced weight at birth, skeletal defects and reduced female and male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Wdr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Wdr48 APN 9 119905390 missense probably damaging 1.00
IGL02005:Wdr48 APN 9 119905389 missense probably damaging 1.00
IGL02097:Wdr48 APN 9 119924263 missense probably damaging 1.00
IGL02217:Wdr48 APN 9 119909535 missense probably benign 0.01
IGL02416:Wdr48 APN 9 119924760 missense probably damaging 0.98
IGL03198:Wdr48 APN 9 119912413 missense probably benign 0.01
R0109:Wdr48 UTSW 9 119918568 splice site probably benign
R1753:Wdr48 UTSW 9 119924247 nonsense probably null
R1829:Wdr48 UTSW 9 119904330 missense probably benign 0.03
R1837:Wdr48 UTSW 9 119905416 missense probably damaging 0.99
R1881:Wdr48 UTSW 9 119909540 missense probably benign 0.00
R1916:Wdr48 UTSW 9 119912417 missense probably benign 0.01
R2039:Wdr48 UTSW 9 119909387 missense probably damaging 1.00
R2421:Wdr48 UTSW 9 119902404 missense probably damaging 1.00
R3031:Wdr48 UTSW 9 119924110 missense probably benign 0.02
R3719:Wdr48 UTSW 9 119907131 missense probably damaging 1.00
R6014:Wdr48 UTSW 9 119924709 missense probably damaging 1.00
R6054:Wdr48 UTSW 9 119907777 missense probably damaging 1.00
R6182:Wdr48 UTSW 9 119924766 missense probably damaging 1.00
R6285:Wdr48 UTSW 9 119920610 missense probably damaging 1.00
R6434:Wdr48 UTSW 9 119916813 missense possibly damaging 0.94
R7167:Wdr48 UTSW 9 119907789 critical splice donor site probably null
R7282:Wdr48 UTSW 9 119911081 missense probably damaging 1.00
R7567:Wdr48 UTSW 9 119916828 missense possibly damaging 0.66
R7912:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
R7993:Wdr48 UTSW 9 119904339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTTACAGAACCAGCAGGCAG -3'
(R):5'- AGGAAGTTATCCATGCCCCAGAGAG -3'

Sequencing Primer
(F):5'- CAAGGGCATGTTGGCTCTG -3'
(R):5'- GATTCTGCTGTACATACCCAAAG -3'
Posted On2014-05-28