Incidental Mutation 'R0005:Vsx2'
ID201308
Institutional Source Beutler Lab
Gene Symbol Vsx2
Ensembl Gene ENSMUSG00000021239
Gene Namevisual system homeobox 2
SynonymsHox10, Chx10, Hox-10
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R0005 (G1)
Quality Score65
Status Validated
Chromosome12
Chromosomal Location84569762-84595457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84570241 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 100 (P100Q)
Ref Sequence ENSEMBL: ENSMUSP00000131009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021665] [ENSMUST00000169934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021665
AA Change: P100Q

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021665
Gene: ENSMUSG00000021239
AA Change: P100Q

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 284 295 N/A INTRINSIC
Pfam:OAR 299 319 4.3e-10 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169934
AA Change: P100Q

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131009
Gene: ENSMUSG00000021239
AA Change: P100Q

DomainStartEndE-ValueType
low complexity region 77 86 N/A INTRINSIC
low complexity region 122 132 N/A INTRINSIC
HOX 148 210 4e-26 SMART
low complexity region 303 314 N/A INTRINSIC
Pfam:OAR 319 337 6.6e-10 PFAM
low complexity region 353 369 N/A INTRINSIC
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the Vsx (visual system homeobox) family which belongs to the larger PRD homeobox class. The encoded protein is required for eye organogenesis and controls retinal development. Disruption of this gene is associated with ocular retardation J (orJ), a mouse disease which causes microphthalmia, retinal degeneration and optic nerve aplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microphthalmia, lack of retinal intercellular channels, and agenesis of the optic nerve. Homozygotes for one mutant allele also have a germ cell maturation defect with sterility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Vsx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:Vsx2 APN 12 84570300 missense probably benign 0.09
R0413:Vsx2 UTSW 12 84570003 missense probably benign 0.00
R1256:Vsx2 UTSW 12 84576311 missense probably damaging 1.00
R3438:Vsx2 UTSW 12 84570211 missense probably damaging 0.98
R5199:Vsx2 UTSW 12 84593210 missense probably benign 0.31
R6481:Vsx2 UTSW 12 84593104 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATTGGCTGTTCAGCTCTGACCC -3'
(R):5'- GGACTGACACTAGGTCCCAAGAACTG -3'

Sequencing Primer
(F):5'- CTAGGCTTGAACAAGGAGCCTC -3'
(R):5'- AAAACCCTTGGAGTTTGGGTC -3'
Posted On2014-05-28