Incidental Mutation 'R0005:Gm8909'
ID201309
Institutional Source Beutler Lab
Gene Symbol Gm8909
Ensembl Gene ENSMUSG00000073402
Gene Namepredicted gene 8909
Synonyms
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0005 (G1)
Quality Score40
Status Validated
Chromosome17
Chromosomal Location36164443-36168537 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 36162192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040467] [ENSMUST00000097335] [ENSMUST00000173353]
Predicted Effect probably benign
Transcript: ENSMUST00000040467
SMART Domains Protein: ENSMUSP00000036092
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 26 204 5.9e-96 PFAM
IGc1 223 294 8.23e-23 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090537
SMART Domains Protein: ENSMUSP00000088025
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 105 173 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097335
SMART Domains Protein: ENSMUSP00000094947
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 7.3e-96 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173025
SMART Domains Protein: ENSMUSP00000133655
Gene: ENSMUSG00000038311

DomainStartEndE-ValueType
SCOP:d2sqca2 148 216 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173353
SMART Domains Protein: ENSMUSP00000133663
Gene: ENSMUSG00000073402

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 54 232 3.9e-93 PFAM
IGc1 251 322 8.23e-23 SMART
transmembrane domain 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174752
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Gm8909
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Gm8909 APN 17 36165354 critical splice donor site probably null
IGL00534:Gm8909 APN 17 36168129 missense probably damaging 1.00
IGL02312:Gm8909 APN 17 36165407 missense probably benign 0.01
IGL03346:Gm8909 APN 17 36168109 missense probably damaging 1.00
H8441:Gm8909 UTSW 17 36167982 missense possibly damaging 0.84
R0078:Gm8909 UTSW 17 36165461 missense possibly damaging 0.95
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0211:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0233:Gm8909 UTSW 17 36167469 missense probably benign 0.42
R0553:Gm8909 UTSW 17 36168057 missense probably damaging 1.00
R0670:Gm8909 UTSW 17 36168098 missense possibly damaging 0.74
R1718:Gm8909 UTSW 17 36161784 unclassified probably benign
R1937:Gm8909 UTSW 17 36168007 missense probably damaging 1.00
R2571:Gm8909 UTSW 17 36167661 missense possibly damaging 0.66
R4393:Gm8909 UTSW 17 36161969 unclassified probably benign
R4396:Gm8909 UTSW 17 36161969 unclassified probably benign
R4409:Gm8909 UTSW 17 36165850 missense possibly damaging 0.53
R4505:Gm8909 UTSW 17 36161480 unclassified probably benign
R4506:Gm8909 UTSW 17 36161480 unclassified probably benign
R4507:Gm8909 UTSW 17 36161480 unclassified probably benign
R4579:Gm8909 UTSW 17 36161757 unclassified probably benign
R4684:Gm8909 UTSW 17 36165858 missense possibly damaging 0.90
R4740:Gm8909 UTSW 17 36167556 missense probably damaging 1.00
R5087:Gm8909 UTSW 17 36165416 nonsense probably null
R5103:Gm8909 UTSW 17 36161685 unclassified probably benign
R5275:Gm8909 UTSW 17 36161675 unclassified probably null
R5425:Gm8909 UTSW 17 36168485 missense probably damaging 1.00
R6155:Gm8909 UTSW 17 36167507 missense possibly damaging 0.93
R6727:Gm8909 UTSW 17 36165730 missense probably damaging 1.00
R6852:Gm8909 UTSW 17 36168073 missense possibly damaging 0.52
Z1177:Gm8909 UTSW 17 36165712 missense not run
Predicted Primers PCR Primer
(F):5'- AATACCGCATCGAGTGTGAGCCTG -3'
(R):5'- TGCAGTTCTCCAACAATCTTCCTGG -3'

Sequencing Primer
(F):5'- GCGCAGTGAAACCCTGAC -3'
(R):5'- TGCCTGAAGATGAGGAATTATCC -3'
Posted On2014-05-28