Incidental Mutation 'R0014:9130409I23Rik'
ID201317
Institutional Source Beutler Lab
Gene Symbol 9130409I23Rik
Ensembl Gene ENSMUSG00000038768
Gene NameRIKEN cDNA 9130409I23 gene
Synonyms
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0014 (G1)
Quality Score62
Status Validated
Chromosome1
Chromosomal Location181051237-181060667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181055131 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 153 (F153L)
Ref Sequence ENSEMBL: ENSMUSP00000042889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036819]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036819
AA Change: F153L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042889
Gene: ENSMUSG00000038768
AA Change: F153L

DomainStartEndE-ValueType
Lipid_DES 5 43 6.12e-15 SMART
Pfam:FA_desaturase 64 295 7.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195319
Meta Mutation Damage Score 0.2275 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in 9130409I23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:9130409I23Rik APN 1 181054898 missense possibly damaging 0.82
IGL03345:9130409I23Rik APN 1 181055372 missense probably benign 0.43
R0014:9130409I23Rik UTSW 1 181055131 missense possibly damaging 0.95
R0522:9130409I23Rik UTSW 1 181059747 missense probably damaging 0.98
R0737:9130409I23Rik UTSW 1 181055379 missense probably benign 0.15
R1710:9130409I23Rik UTSW 1 181051319 start codon destroyed probably null 0.98
R1809:9130409I23Rik UTSW 1 181059687 missense probably damaging 0.98
R2029:9130409I23Rik UTSW 1 181054931 missense probably benign 0.04
R5814:9130409I23Rik UTSW 1 181055098 missense probably damaging 1.00
R7445:9130409I23Rik UTSW 1 181055012 missense possibly damaging 0.92
Z1177:9130409I23Rik UTSW 1 181055417 missense probably damaging 1.00
Z1177:9130409I23Rik UTSW 1 181059771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAACCGCTGGTTTGGAATATTTGC -3'
(R):5'- GTGATAGCCCACATTGAAGGTGAGC -3'

Sequencing Primer
(F):5'- GGTTTGGAATATTTGCTAACCTCC -3'
(R):5'- GCCACTTATTGGGTGCAAAC -3'
Posted On2014-06-02