Incidental Mutation 'R0014:Tbc1d20'
ID201319
Institutional Source Beutler Lab
Gene Symbol Tbc1d20
Ensembl Gene ENSMUSG00000027465
Gene NameTBC1 domain family, member 20
Synonyms
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R0014 (G1)
Quality Score47
Status Validated
Chromosome2
Chromosomal Location152293828-152313996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152311781 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 342 (Q342L)
Ref Sequence ENSEMBL: ENSMUSP00000028963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000028964] [ENSMUST00000109847] [ENSMUST00000144252] [ENSMUST00000147591]
Predicted Effect probably benign
Transcript: ENSMUST00000028963
AA Change: Q342L

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465
AA Change: Q342L

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028964
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109847
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141373
Predicted Effect probably benign
Transcript: ENSMUST00000144252
SMART Domains Protein: ENSMUSP00000122542
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 8 80 5.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147591
SMART Domains Protein: ENSMUSP00000119209
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
Pfam:RabGAP-TBC 11 155 2e-24 PFAM
Meta Mutation Damage Score 0.0785 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of GTPase activator proteins of Rab-like small GTPases. The encoded protein and its cognate GTPase, Rab1, bind the nonstructural protein 5A (NS5A) of the hepatitis C virus (HCV) to mediate viral replication. Depletion of this protein inhibits replication of the virus and HCV infection. Mutations in this gene are associated with Warburg micro syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous mutants have bilateral cataracts, small eyes, glossy coats, and are male sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Tbc1d20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Tbc1d20 APN 2 152308058 missense probably damaging 0.99
IGL03111:Tbc1d20 APN 2 152308078 missense probably damaging 1.00
R2484:Tbc1d20 UTSW 2 152311363 missense probably damaging 1.00
R3683:Tbc1d20 UTSW 2 152311817 missense probably benign 0.05
R4352:Tbc1d20 UTSW 2 152308194 intron probably benign
R4815:Tbc1d20 UTSW 2 152311989 unclassified probably benign
R4908:Tbc1d20 UTSW 2 152302308 missense probably benign 0.08
R5010:Tbc1d20 UTSW 2 152293936 unclassified probably benign
R5635:Tbc1d20 UTSW 2 152311461 missense probably benign 0.18
R5800:Tbc1d20 UTSW 2 152308325 splice site probably null
R5832:Tbc1d20 UTSW 2 152311362 missense possibly damaging 0.93
R7193:Tbc1d20 UTSW 2 152311417 missense probably benign 0.01
R7346:Tbc1d20 UTSW 2 152304961 missense probably benign 0.02
R7705:Tbc1d20 UTSW 2 152308084 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308008 missense probably damaging 1.00
Z1177:Tbc1d20 UTSW 2 152308093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTTGGAAATCAGACCATCCC -3'
(R):5'- CTTTCATCCCAAGGCTGGACCATC -3'

Sequencing Primer
(F):5'- ATCCCTGGAGTCTACTTGTCTAGAG -3'
(R):5'- GGCCCAACTTTTTAGGCAG -3'
Posted On2014-06-02