Incidental Mutation 'R0014:Man2c1'
ID201329
Institutional Source Beutler Lab
Gene Symbol Man2c1
Ensembl Gene ENSMUSG00000032295
Gene Namemannosidase, alpha, class 2C, member 1
Synonyms
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0014 (G1)
Quality Score67
Status Validated
Chromosome9
Chromosomal Location57130690-57142722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57139701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 580 (M580K)
Ref Sequence ENSEMBL: ENSMUSP00000124020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000034842] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161338] [ENSMUST00000161663] [ENSMUST00000162915] [ENSMUST00000186410] [ENSMUST00000190245]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
AA Change: M677K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295
AA Change: M677K

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034842
SMART Domains Protein: ENSMUSP00000034842
Gene: ENSMUSG00000032298

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.2e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159101
AA Change: M183K
SMART Domains Protein: ENSMUSP00000124304
Gene: ENSMUSG00000032295
AA Change: M183K

DomainStartEndE-ValueType
Alpha-mann_mid 21 100 1.22e-32 SMART
low complexity region 110 120 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160042
Predicted Effect probably benign
Transcript: ENSMUST00000160147
AA Change: M679K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295
AA Change: M679K

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160280
Predicted Effect unknown
Transcript: ENSMUST00000160426
AA Change: D134E
SMART Domains Protein: ENSMUSP00000124005
Gene: ENSMUSG00000032295
AA Change: D134E

DomainStartEndE-ValueType
Alpha-mann_mid 24 77 4.48e-1 SMART
low complexity region 87 97 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
AA Change: M580K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295
AA Change: M580K

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161338
Predicted Effect probably benign
Transcript: ENSMUST00000161663
AA Change: M720K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295
AA Change: M720K

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162634
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Predicted Effect probably benign
Transcript: ENSMUST00000186410
SMART Domains Protein: ENSMUSP00000141048
Gene: ENSMUSG00000032298

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190245
SMART Domains Protein: ENSMUSP00000139917
Gene: ENSMUSG00000032298

DomainStartEndE-ValueType
Fapy_DNA_glyco 2 124 2.9e-16 SMART
H2TH 139 224 9.35e-2 SMART
Pfam:Neil1-DNA_bind 252 290 2.1e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: Germ line null mutants display neuronal and glia degeneration, glycogen accumulation, and liver and kidney damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Man2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Man2c1 APN 9 57141819 missense probably benign
IGL01408:Man2c1 APN 9 57141600 missense probably damaging 1.00
IGL01618:Man2c1 APN 9 57141556 unclassified probably benign
IGL01750:Man2c1 APN 9 57140780 critical splice donor site probably null
IGL01796:Man2c1 APN 9 57137960 missense possibly damaging 0.52
IGL02661:Man2c1 APN 9 57137482 missense probably damaging 1.00
IGL03166:Man2c1 APN 9 57139098 missense probably damaging 1.00
IGL03176:Man2c1 APN 9 57140746 missense probably benign 0.05
IGL03209:Man2c1 APN 9 57141830 missense probably benign 0.00
R0329:Man2c1 UTSW 9 57141183 missense probably benign 0.40
R0432:Man2c1 UTSW 9 57135597 missense probably damaging 1.00
R1448:Man2c1 UTSW 9 57135219 missense probably benign 0.23
R1616:Man2c1 UTSW 9 57135509 missense probably benign 0.00
R1838:Man2c1 UTSW 9 57137337 missense probably benign 0.07
R2511:Man2c1 UTSW 9 57141388 splice site probably null
R3751:Man2c1 UTSW 9 57140774 missense probably damaging 1.00
R3771:Man2c1 UTSW 9 57140377 unclassified probably benign
R3772:Man2c1 UTSW 9 57140377 unclassified probably benign
R4110:Man2c1 UTSW 9 57136771 missense probably damaging 0.98
R4116:Man2c1 UTSW 9 57140305 critical splice donor site probably null
R4167:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4169:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4170:Man2c1 UTSW 9 57138026 missense probably benign 0.15
R4405:Man2c1 UTSW 9 57139083 missense probably damaging 0.98
R4551:Man2c1 UTSW 9 57131161 missense probably damaging 1.00
R4618:Man2c1 UTSW 9 57142155 unclassified probably null
R4798:Man2c1 UTSW 9 57141185 nonsense probably null
R4903:Man2c1 UTSW 9 57138956 missense probably benign 0.08
R5030:Man2c1 UTSW 9 57140639 missense probably benign 0.00
R5079:Man2c1 UTSW 9 57136716 missense probably damaging 1.00
R5086:Man2c1 UTSW 9 57131640 missense probably damaging 0.96
R6430:Man2c1 UTSW 9 57131233 missense possibly damaging 0.91
R6695:Man2c1 UTSW 9 57141591 missense probably benign 0.03
R6743:Man2c1 UTSW 9 57135565 missense probably benign 0.41
R7011:Man2c1 UTSW 9 57137833 missense probably damaging 1.00
R7493:Man2c1 UTSW 9 57141128 missense probably damaging 0.98
R7513:Man2c1 UTSW 9 57139399 missense probably benign 0.44
R7527:Man2c1 UTSW 9 57137816 nonsense probably null
R7540:Man2c1 UTSW 9 57140275 missense probably damaging 1.00
R7760:Man2c1 UTSW 9 57139363 missense probably benign 0.23
R7868:Man2c1 UTSW 9 57137986 missense probably damaging 0.99
R7951:Man2c1 UTSW 9 57137986 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACAAGGATACTCCCCAGGGAATC -3'
(R):5'- TGTCCAAAGTCACAGAACCGTCAG -3'

Sequencing Primer
(F):5'- GAGAAGTAGCCGTGTACTATCCC -3'
(R):5'- CCCTCCTAAAGCTGTGCATT -3'
Posted On2014-06-02