Incidental Mutation 'R0014:Fyttd1'
ID201339
Institutional Source Beutler Lab
Gene Symbol Fyttd1
Ensembl Gene ENSMUSG00000022800
Gene Nameforty-two-three domain containing 1
Synonyms
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R0014 (G1)
Quality Score77
Status Validated
Chromosome16
Chromosomal Location32877500-32908875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32905554 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 175 (R175Q)
Ref Sequence ENSEMBL: ENSMUSP00000155929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023489] [ENSMUST00000120345] [ENSMUST00000171325] [ENSMUST00000232272]
Predicted Effect probably damaging
Transcript: ENSMUST00000023489
AA Change: R293Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023489
Gene: ENSMUSG00000022800
AA Change: R293Q

DomainStartEndE-ValueType
Pfam:FYTT 10 317 1.7e-176 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120345
AA Change: R105Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113541
Gene: ENSMUSG00000022800
AA Change: R105Q

DomainStartEndE-ValueType
Pfam:FYTT 2 129 1e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137863
Predicted Effect probably damaging
Transcript: ENSMUST00000171325
AA Change: R259Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131446
Gene: ENSMUSG00000022800
AA Change: R259Q

DomainStartEndE-ValueType
Pfam:FYTT 3 210 6.8e-137 PFAM
Pfam:FYTT 209 283 4.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232272
AA Change: R175Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232300
Meta Mutation Damage Score 0.6754 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Fyttd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Fyttd1 APN 16 32900661 missense probably damaging 0.99
IGL03119:Fyttd1 APN 16 32900695 missense probably benign 0.08
R0014:Fyttd1 UTSW 16 32905554 missense probably damaging 1.00
R1742:Fyttd1 UTSW 16 32905553 nonsense probably null
R5018:Fyttd1 UTSW 16 32902417 critical splice acceptor site probably null
R5800:Fyttd1 UTSW 16 32891288 missense probably damaging 1.00
R5893:Fyttd1 UTSW 16 32898913 missense probably damaging 1.00
R7325:Fyttd1 UTSW 16 32884248 missense probably benign 0.43
Z1177:Fyttd1 UTSW 16 32877784 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATAGATAGTAGGAGTAGGCCACC -3'
(R):5'- AACTTCTCCGATGAACTCTTCAAGCAAA -3'

Sequencing Primer
(F):5'- gagttcaattcccagcaacc -3'
(R):5'- GAACTCTTCAAGCAAATCAACTTTTC -3'
Posted On2014-06-02