Incidental Mutation 'R0019:Il1r2'
ID201341
Institutional Source Beutler Lab
Gene Symbol Il1r2
Ensembl Gene ENSMUSG00000026073
Gene Nameinterleukin 1 receptor, type II
SynonymsIL-1 receptor beta chain, CD121b, Il1r-2
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0019 (G1)
Quality Score75
Status Validated
Chromosome1
Chromosomal Location40074079-40125231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40125050 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 359 (T359M)
Ref Sequence ENSEMBL: ENSMUSP00000027243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027243] [ENSMUST00000195770]
Predicted Effect probably damaging
Transcript: ENSMUST00000027243
AA Change: T359M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027243
Gene: ENSMUSG00000026073
AA Change: T359M

DomainStartEndE-ValueType
IG 49 138 2.48e-8 SMART
IG 149 241 1.6e-2 SMART
IG 255 354 1.32e-3 SMART
transmembrane domain 359 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195770
Meta Mutation Damage Score 0.2327 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Il1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01945:Il1r2 APN 1 40102453 missense possibly damaging 0.66
IGL02673:Il1r2 APN 1 40115163 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0299:Il1r2 UTSW 1 40123149 nonsense probably null
R0499:Il1r2 UTSW 1 40123149 nonsense probably null
R0607:Il1r2 UTSW 1 40105455 missense probably benign 0.06
R1435:Il1r2 UTSW 1 40105299 missense probably damaging 0.99
R1925:Il1r2 UTSW 1 40115148 missense probably damaging 0.99
R2209:Il1r2 UTSW 1 40115138 missense probably benign 0.02
R2240:Il1r2 UTSW 1 40105470 missense probably damaging 1.00
R4997:Il1r2 UTSW 1 40121046 critical splice donor site probably null
R7273:Il1r2 UTSW 1 40112007 missense probably benign 0.06
R7331:Il1r2 UTSW 1 40123249 missense probably benign 0.11
R7401:Il1r2 UTSW 1 40123210 missense probably damaging 1.00
R7751:Il1r2 UTSW 1 40123211 missense probably damaging 1.00
R7841:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
R7924:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
X0010:Il1r2 UTSW 1 40117981 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAGGTGTCATCCTCAAAGGGCTTAG -3'
(R):5'- ACTGTAAGGATCAGACCCAGAGGAC -3'

Sequencing Primer
(F):5'- GCTGTAAGAGACAAGTTTTCCAG -3'
(R):5'- accccaccccaccctac -3'
Posted On2014-06-02