Incidental Mutation 'R0019:Pdcl'
ID201342
Institutional Source Beutler Lab
Gene Symbol Pdcl
Ensembl Gene ENSMUSG00000009030
Gene Namephosducin-like
Synonyms1200011E13Rik, PhLP1
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R0019 (G1)
Quality Score68
Status Validated
Chromosome2
Chromosomal Location37350074-37359332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37351920 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 273 (L273M)
Ref Sequence ENSEMBL: ENSMUSP00000108562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009174] [ENSMUST00000112940] [ENSMUST00000138314] [ENSMUST00000147703]
Predicted Effect probably damaging
Transcript: ENSMUST00000009174
AA Change: L273M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009174
Gene: ENSMUSG00000009030
AA Change: L273M

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112940
AA Change: L273M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108562
Gene: ENSMUSG00000009030
AA Change: L273M

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 299 8.6e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138314
SMART Domains Protein: ENSMUSP00000145483
Gene: ENSMUSG00000009030

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147703
SMART Domains Protein: ENSMUSP00000119372
Gene: ENSMUSG00000009030

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
Pfam:Phosducin 35 193 6.8e-90 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosducin-like protein is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin, a phosphoprotein expressed in retina and pineal gland. Both phosducin-like protein and phosphoducin have been shown to regulate G-protein signaling by binding to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Pdcl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Pdcl APN 2 37357374 start codon destroyed probably null 1.00
R0019:Pdcl UTSW 2 37351920 missense probably damaging 0.99
R0147:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0148:Pdcl UTSW 2 37352130 missense probably benign 0.00
R0157:Pdcl UTSW 2 37352177 missense probably damaging 1.00
R1876:Pdcl UTSW 2 37355696 missense probably damaging 0.99
R2202:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2203:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2204:Pdcl UTSW 2 37352044 missense probably benign 0.28
R2896:Pdcl UTSW 2 37355690 missense possibly damaging 0.93
R3961:Pdcl UTSW 2 37352187 missense probably benign 0.00
R4010:Pdcl UTSW 2 37352111 missense probably damaging 1.00
R4663:Pdcl UTSW 2 37355766 missense probably damaging 1.00
R6896:Pdcl UTSW 2 37352179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACATTGCCTGCAAGGGTGC -3'
(R):5'- CGTCAAATTCTGTCGGGTGAGGAG -3'

Sequencing Primer
(F):5'- GCTACAAAGTGAGTCAGCATTCTG -3'
(R):5'- GCGGGTGAATTGATTGGCAA -3'
Posted On2014-06-02