Incidental Mutation 'R0019:Fshb'
ID201343
Institutional Source Beutler Lab
Gene Symbol Fshb
Ensembl Gene ENSMUSG00000027120
Gene Namefollicle stimulating hormone beta
SynonymsFSH, Fshbeta
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R0019 (G1)
Quality Score20
Status Validated
Chromosome2
Chromosomal Location107056140-107059656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107057345 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 110 (S110G)
Ref Sequence ENSEMBL: ENSMUSP00000028533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028533]
Predicted Effect probably benign
Transcript: ENSMUST00000028533
AA Change: S110G

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028533
Gene: ENSMUSG00000027120
AA Change: S110G

DomainStartEndE-ValueType
GHB 18 124 7.2e-67 SMART
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. [provided by RefSeq, Aug 2015]
PHENOTYPE: Females homozygous for a targeted null mutation are sterile with a preantral block in folliculogenesis. Mutant males have small testes and reduced Sertoli and germ cell numbers, but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Fshb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Fshb APN 2 107058927 missense probably benign 0.00
IGL01985:Fshb APN 2 107058828 missense probably benign 0.00
IGL02756:Fshb APN 2 107058873 missense probably damaging 1.00
IGL03083:Fshb APN 2 107057467 missense probably benign 0.00
R0019:Fshb UTSW 2 107057345 missense probably benign 0.22
R4754:Fshb UTSW 2 107057282 makesense probably null
R5197:Fshb UTSW 2 107057509 missense possibly damaging 0.85
R5319:Fshb UTSW 2 107058879 missense probably damaging 0.99
R6173:Fshb UTSW 2 107057293 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTCTGATGGCTCTAAAAGGCAGACG -3'
(R):5'- TCTGGTGTATAAGGACCCAGCTCG -3'

Sequencing Primer
(F):5'- TATCTGTCAGGACAGCGGAC -3'
(R):5'- GGCCCAATACCCAGAAAGTATG -3'
Posted On2014-06-02