Incidental Mutation 'R0019:Ywhab'
ID201345
Institutional Source Beutler Lab
Gene Symbol Ywhab
Ensembl Gene ENSMUSG00000018326
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide
Synonyms14-3-3 beta, 1300003C17Rik
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0019 (G1)
Quality Score52
Status Validated
Chromosome2
Chromosomal Location163994960-164018588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164016170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 219 (I219N)
Ref Sequence ENSEMBL: ENSMUSP00000018470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018470] [ENSMUST00000131288]
PDB Structure
Complex of ChREBP and 14-3-3beta [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018470
AA Change: I219N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018470
Gene: ENSMUSG00000018326
AA Change: I219N

DomainStartEndE-ValueType
14_3_3 5 244 7.42e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131288
SMART Domains Protein: ENSMUSP00000117125
Gene: ENSMUSG00000018326

DomainStartEndE-ValueType
14_3_3 5 159 1.46e-35 SMART
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the 14-3-3 family of proteins, members of which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals. The encoded protein has been shown to interact with RAF1 and CDC25 phosphatases, suggesting that it may play a role in linking mitogenic signaling and the cell cycle machinery. Two transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Ywhab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Ywhab APN 2 164011774 missense possibly damaging 0.94
IGL02524:Ywhab APN 2 164016137 missense probably damaging 1.00
IGL03135:Ywhab APN 2 164015275 missense probably benign 0.06
IGL03255:Ywhab APN 2 164014016 missense probably benign 0.01
R0019:Ywhab UTSW 2 164016170 missense probably damaging 1.00
R1992:Ywhab UTSW 2 164011887 missense probably damaging 1.00
R4795:Ywhab UTSW 2 164015345 missense probably damaging 1.00
R7153:Ywhab UTSW 2 164014060 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTGGATTCTACACCGTGAGCCC -3'
(R):5'- TGACTGACAAGGCATAAAGTCCAGC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgtgtgAGATATG -3'
(R):5'- GCATAAAGTCCAGCAGTAAGATAC -3'
Posted On2014-06-02