Incidental Mutation 'R0019:Ankrd13a'
ID201348
Institutional Source Beutler Lab
Gene Symbol Ankrd13a
Ensembl Gene ENSMUSG00000041870
Gene Nameankyrin repeat domain 13a
Synonyms
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0019 (G1)
Quality Score28
Status Validated
Chromosome5
Chromosomal Location114774677-114806200 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 114786081 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000102578]
Predicted Effect probably benign
Transcript: ENSMUST00000102578
SMART Domains Protein: ENSMUSP00000099638
Gene: ENSMUSG00000041870

DomainStartEndE-ValueType
ANK 40 69 1.51e-4 SMART
ANK 73 104 2.03e-1 SMART
Pfam:GPCR_chapero_1 156 468 5.5e-107 PFAM
UIM 480 500 2.98e2 SMART
UIM 517 536 2.01e1 SMART
UIM 547 566 5.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137519
SMART Domains Protein: ENSMUSP00000116994
Gene: ENSMUSG00000041870

DomainStartEndE-ValueType
ANK 7 38 2.03e-1 SMART
Pfam:GPCR_chapero_1 90 403 8.2e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140604
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Ankrd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Ankrd13a APN 5 114801802 missense probably damaging 0.99
IGL01303:Ankrd13a APN 5 114786002 missense possibly damaging 0.94
IGL01392:Ankrd13a APN 5 114797853 missense probably benign
IGL01480:Ankrd13a APN 5 114800818 splice site probably benign
IGL01652:Ankrd13a APN 5 114791336 missense probably damaging 1.00
IGL02213:Ankrd13a APN 5 114785968 missense probably damaging 1.00
IGL02512:Ankrd13a APN 5 114786766 missense probably benign 0.16
IGL03268:Ankrd13a APN 5 114792235 missense probably damaging 1.00
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0465:Ankrd13a UTSW 5 114804234 missense probably damaging 0.98
R0960:Ankrd13a UTSW 5 114786807 missense probably benign 0.03
R1222:Ankrd13a UTSW 5 114800763 nonsense probably null
R1538:Ankrd13a UTSW 5 114804234 missense possibly damaging 0.87
R1667:Ankrd13a UTSW 5 114786733 missense possibly damaging 0.89
R1771:Ankrd13a UTSW 5 114803588 missense probably benign 0.08
R2015:Ankrd13a UTSW 5 114792109 missense probably damaging 1.00
R4547:Ankrd13a UTSW 5 114775296 missense probably benign 0.01
R4569:Ankrd13a UTSW 5 114789312 missense probably damaging 1.00
R5401:Ankrd13a UTSW 5 114792173 missense probably damaging 1.00
R5635:Ankrd13a UTSW 5 114801717 missense possibly damaging 0.95
R6238:Ankrd13a UTSW 5 114786726 missense probably benign 0.00
R6562:Ankrd13a UTSW 5 114804392 unclassified probably benign
R6623:Ankrd13a UTSW 5 114786757 missense probably benign 0.28
R6772:Ankrd13a UTSW 5 114801743 missense probably benign 0.00
R7146:Ankrd13a UTSW 5 114775232 missense probably damaging 1.00
R7440:Ankrd13a UTSW 5 114803575 missense possibly damaging 0.65
R7567:Ankrd13a UTSW 5 114789484 intron probably null
R7849:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R7932:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTGACACCAGTGTTTGCTTCACAG -3'
(R):5'- GCCCACTTACTAGCCTGAAACTGC -3'

Sequencing Primer
(F):5'- GTTTGCTTCACAGAATGCAGAG -3'
(R):5'- GCCTGGTCTACATGAAACTACTG -3'
Posted On2014-06-02