Incidental Mutation 'R0019:Lrig1'
List |< first << previous [record 27 of 59] next >> last >|
ID201349
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Nameleucine-rich repeats and immunoglobulin-like domains 1
SynonymsLIG-1, Img
MMRRC Submission 038314-MU
Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0019 (G1)
Quality Score57
Status Validated
Chromosome6
Chromosomal Location94604529-94700158 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 94607349 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 905 (R905*)
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000061118] [ENSMUST00000101126] [ENSMUST00000204235] [ENSMUST00000204645] [ENSMUST00000204764]
Predicted Effect probably null
Transcript: ENSMUST00000032105
AA Change: R905*
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: R905*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061118
SMART Domains Protein: ENSMUSP00000058028
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 82 7e-14 PFAM
Pfam:Mito_carr 84 173 4e-16 PFAM
Pfam:Mito_carr 176 269 2.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101126
AA Change: R905*
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: R905*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203876
Predicted Effect probably benign
Transcript: ENSMUST00000204235
SMART Domains Protein: ENSMUSP00000145328
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 43 2.7e-7 PFAM
Pfam:Mito_carr 38 82 8.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204645
AA Change: R905*
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: R905*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204764
SMART Domains Protein: ENSMUSP00000144816
Gene: ENSMUSG00000045100

DomainStartEndE-ValueType
Pfam:Mito_carr 2 44 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205173
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94611404 missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94654920 missense probably benign 0.00
IGL01356:Lrig1 APN 6 94609893 missense probably damaging 1.00
IGL02001:Lrig1 APN 6 94607324 missense probably benign 0.00
IGL02019:Lrig1 APN 6 94616429 missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94663996 missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94663938 missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94606118 missense probably benign
IGL03263:Lrig1 APN 6 94611647 missense probably benign 0.00
IGL03327:Lrig1 APN 6 94606123 missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94609087 missense probably benign
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0961:Lrig1 UTSW 6 94663914 splice site probably benign
R1018:Lrig1 UTSW 6 94622602 splice site probably benign
R1381:Lrig1 UTSW 6 94606130 missense probably benign 0.04
R1473:Lrig1 UTSW 6 94607313 missense probably benign 0.16
R1498:Lrig1 UTSW 6 94627987 missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R2273:Lrig1 UTSW 6 94608143 missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94617366 intron probably null
R3001:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94605817 missense probably benign 0.00
R4089:Lrig1 UTSW 6 94609859 missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4095:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4225:Lrig1 UTSW 6 94622658 missense probably damaging 1.00
R4917:Lrig1 UTSW 6 94609719 missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94663978 missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94625062 missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94611449 missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94628044 missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94699539 nonsense probably null
R5988:Lrig1 UTSW 6 94628042 missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94626447 missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94616445 missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94626405 missense probably damaging 1.00
R6815:Lrig1 UTSW 6 94625029 missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94625063 missense probably benign 0.07
R6995:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
R7404:Lrig1 UTSW 6 94626471 missense probably damaging 1.00
R7487:Lrig1 UTSW 6 94606118 missense probably benign
R7732:Lrig1 UTSW 6 94626377 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGAAGTGAAACCTTGTCGGGACAAC -3'
(R):5'- TGCTGGGAAAAGCAGTGGTCTG -3'

Sequencing Primer
(F):5'- TCATAGACTGACTTACCTAAGCG -3'
(R):5'- AAAGCAGTGGTCTGGTGGC -3'
Posted On2014-06-02