Incidental Mutation 'R0019:Pycrl'
ID201357
Institutional Source Beutler Lab
Gene Symbol Pycrl
Ensembl Gene ENSMUSG00000022571
Gene Namepyrroline-5-carboxylate reductase-like
Synonyms
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R0019 (G1)
Quality Score35
Status Validated
Chromosome15
Chromosomal Location75916477-75921560 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 75919306 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053918] [ENSMUST00000192937]
Predicted Effect probably benign
Transcript: ENSMUST00000053918
SMART Domains Protein: ENSMUSP00000049605
Gene: ENSMUSG00000022571

DomainStartEndE-ValueType
Pfam:F420_oxidored 10 104 1.2e-17 PFAM
Pfam:P5CR_dimer 166 270 5.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192937
SMART Domains Protein: ENSMUSP00000141473
Gene: ENSMUSG00000103906

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
Pfam:CENP-B_N 63 112 1.6e-10 PFAM
CENPB 128 195 1.41e-13 SMART
Pfam:DDE_1 238 377 8.2e-21 PFAM
low complexity region 554 567 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the pyrroline-5-carboxylate reductase family of enzymes. Members of this family catalyze the final step in proline biosynthesis, converting pyrroline-5-carboxylate to proline. Glutamate and ornithine are precursors in the synthesis of proline. The protein encoded by this gene is a cytoplasmic enzyme involved in the biosynthesis of proline from ornithine. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim69 A T 2: 122,174,477 probably null Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Pycrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Pycrl APN 15 75917004 missense probably damaging 1.00
IGL02738:Pycrl APN 15 75918716 missense probably damaging 0.97
R0426:Pycrl UTSW 15 75918388 missense probably benign 0.38
R1183:Pycrl UTSW 15 75918798 missense probably benign 0.14
R2041:Pycrl UTSW 15 75919295 critical splice acceptor site probably null
R4289:Pycrl UTSW 15 75918806 missense probably benign 0.00
R4346:Pycrl UTSW 15 75918731 missense probably damaging 1.00
R7131:Pycrl UTSW 15 75918695 missense possibly damaging 0.93
R7775:Pycrl UTSW 15 75918289 missense probably damaging 0.99
R7778:Pycrl UTSW 15 75918289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGAGTAGTCTGGCAACCCAGAG -3'
(R):5'- TGGTCCCAGTGTCCAACAGAAACG -3'

Sequencing Primer
(F):5'- TGTGTGAGGCAGCATCCTAC -3'
(R):5'- TCCAACAGAAACGGCAGTG -3'
Posted On2014-06-02