Incidental Mutation 'R0020:Fhl5'
ID201365
Institutional Source Beutler Lab
Gene Symbol Fhl5
Ensembl Gene ENSMUSG00000028259
Gene Namefour and a half LIM domains 5
SynonymsACT, 1700027G07Rik
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0020 (G1)
Quality Score27
Status Validated
Chromosome4
Chromosomal Location25199908-25242876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25200054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 260 (V260E)
Ref Sequence ENSEMBL: ENSMUSP00000103839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029922] [ENSMUST00000108204]
Predicted Effect probably benign
Transcript: ENSMUST00000029922
AA Change: V260E

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029922
Gene: ENSMUSG00000028259
AA Change: V260E

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108204
AA Change: V260E

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103839
Gene: ENSMUSG00000028259
AA Change: V260E

DomainStartEndE-ValueType
LIM 40 93 1.91e-11 SMART
LIM 101 154 4.59e-14 SMART
LIM 162 213 3.7e-9 SMART
LIM 221 276 7.68e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Meta Mutation Damage Score 0.1382 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
PHENOTYPE: Male mice homozygous for disruptions of this gene have reduced sperm counts and abnormal sperm but are none the less fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Drc3 A G 11: 60,370,545 Y174C probably damaging Het
Ezr G T 17: 6,742,727 Q308K probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Gon4l G T 3: 88,858,937 V428L probably damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Nphs1 G T 7: 30,463,208 V357L probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Prss43 C A 9: 110,828,512 probably benign Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Fhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Fhl5 APN 4 25207181 missense possibly damaging 0.95
IGL02194:Fhl5 APN 4 25211341 missense probably benign 0.01
IGL03172:Fhl5 APN 4 25211309 missense probably damaging 1.00
PIT4466001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
PIT4472001:Fhl5 UTSW 4 25211194 missense probably damaging 1.00
R0020:Fhl5 UTSW 4 25200054 missense probably benign 0.15
R0256:Fhl5 UTSW 4 25213624 missense probably benign
R0304:Fhl5 UTSW 4 25207241 missense probably benign 0.01
R0480:Fhl5 UTSW 4 25207101 nonsense probably null
R0563:Fhl5 UTSW 4 25213610 missense probably damaging 0.96
R3418:Fhl5 UTSW 4 25211252 missense probably benign
R3926:Fhl5 UTSW 4 25214790 splice site probably benign
R4382:Fhl5 UTSW 4 25200118 missense probably benign 0.16
R5930:Fhl5 UTSW 4 25214756 missense probably benign 0.04
R6135:Fhl5 UTSW 4 25214716 nonsense probably null
R6927:Fhl5 UTSW 4 25213681 missense probably benign 0.14
R7147:Fhl5 UTSW 4 25213777 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGTTTGAAAACATGTCCGTCAGCAG -3'
(R):5'- AGGAATCTTGTGTGGCTGAAATGCTC -3'

Sequencing Primer
(F):5'- TCCTCATTCAAACAGTAGAGTGCAG -3'
(R):5'- ACACCCTGTGGAGTTACTCG -3'
Posted On2014-06-02