Incidental Mutation 'R0020:Drc3'
ID201375
Institutional Source Beutler Lab
Gene Symbol Drc3
Ensembl Gene ENSMUSG00000056598
Gene Namedynein regulatory complex subunit 3
Synonyms4930449E07Rik, Lrrc48, m6Bei
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0020 (G1)
Quality Score44
Status Validated
Chromosome11
Chromosomal Location60353329-60394341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60370545 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 174 (Y174C)
Ref Sequence ENSEMBL: ENSMUSP00000104363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070805] [ENSMUST00000094140] [ENSMUST00000108722] [ENSMUST00000108723]
Predicted Effect probably damaging
Transcript: ENSMUST00000070805
AA Change: Y174C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065525
Gene: ENSMUSG00000056598
AA Change: Y174C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094140
AA Change: Y174C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091691
Gene: ENSMUSG00000056598
AA Change: Y174C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108722
AA Change: Y174C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104362
Gene: ENSMUSG00000056598
AA Change: Y174C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108723
AA Change: Y174C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104363
Gene: ENSMUSG00000056598
AA Change: Y174C

DomainStartEndE-ValueType
low complexity region 66 75 N/A INTRINSIC
LRR 86 106 9.24e1 SMART
LRR 108 129 1.71e1 SMART
LRR 130 153 1.49e1 SMART
low complexity region 216 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128905
Meta Mutation Damage Score 0.5738 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Ezr G T 17: 6,742,727 Q308K probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Fhl5 A T 4: 25,200,054 V260E probably benign Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Gon4l G T 3: 88,858,937 V428L probably damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Nphs1 G T 7: 30,463,208 V357L probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Prss43 C A 9: 110,828,512 probably benign Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Drc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Drc3 APN 11 60364962 missense probably null 0.70
IGL01457:Drc3 APN 11 60358649 utr 5 prime probably benign
IGL02329:Drc3 APN 11 60370578 missense probably damaging 1.00
IGL02576:Drc3 APN 11 60370551 missense probably benign 0.01
IGL02610:Drc3 APN 11 60370593 missense probably benign 0.40
IGL02817:Drc3 APN 11 60384236 missense probably benign 0.16
IGL03380:Drc3 APN 11 60377905 missense probably benign 0.01
R1221:Drc3 UTSW 11 60384226 missense probably benign
R1394:Drc3 UTSW 11 60393719 missense possibly damaging 0.94
R1483:Drc3 UTSW 11 60388889 missense probably benign 0.00
R2093:Drc3 UTSW 11 60370484 missense probably damaging 1.00
R2151:Drc3 UTSW 11 60375157 missense probably benign 0.15
R4631:Drc3 UTSW 11 60364908 missense probably benign 0.02
R4796:Drc3 UTSW 11 60363528 missense probably damaging 1.00
R4841:Drc3 UTSW 11 60370535 missense probably benign 0.00
R4842:Drc3 UTSW 11 60370535 missense probably benign 0.00
R5739:Drc3 UTSW 11 60375130 missense possibly damaging 0.89
R5766:Drc3 UTSW 11 60393821 missense probably benign 0.18
R6143:Drc3 UTSW 11 60370580 missense possibly damaging 0.82
R6298:Drc3 UTSW 11 60393770 missense possibly damaging 0.74
R6558:Drc3 UTSW 11 60364892 missense probably damaging 1.00
R6611:Drc3 UTSW 11 60364947 missense probably damaging 0.99
R6938:Drc3 UTSW 11 60394123 critical splice acceptor site probably null
R7013:Drc3 UTSW 11 60387303 missense probably benign 0.00
R7108:Drc3 UTSW 11 60370554 missense probably benign 0.13
R7640:Drc3 UTSW 11 60388904 missense probably benign
R7713:Drc3 UTSW 11 60370560 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCGCTGCTGACTGCTTTTCATAG -3'
(R):5'- GCCAGGAAAACATGCTCTCTTAGCC -3'

Sequencing Primer
(F):5'- acccatcatctgtcctaaatcc -3'
(R):5'- CATGGACAGGGAGAGCGTC -3'
Posted On2014-06-02