Incidental Mutation 'R0060:Chl1'
ID201403
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R0060 (G1)
Quality Score65
Status Validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 103711058 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect probably benign
Transcript: ENSMUST00000066905
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203830
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203912
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205098
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0685:Chl1 UTSW 6 103708542 splice site probably null
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 splice site probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5523:Chl1 UTSW 6 103708714 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R5986:Chl1 UTSW 6 103709191 missense probably benign 0.45
R6101:Chl1 UTSW 6 103693032 missense probably damaging 0.96
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
R7097:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7122:Chl1 UTSW 6 103706448 missense probably damaging 1.00
R7198:Chl1 UTSW 6 103706556 missense probably damaging 1.00
R7203:Chl1 UTSW 6 103691674 missense probably benign 0.13
R7527:Chl1 UTSW 6 103711201 missense probably damaging 1.00
R7625:Chl1 UTSW 6 103729125 missense probably damaging 1.00
R7667:Chl1 UTSW 6 103695495 missense possibly damaging 0.82
R7683:Chl1 UTSW 6 103691652 missense possibly damaging 0.72
R7712:Chl1 UTSW 6 103711102 missense possibly damaging 0.94
R7838:Chl1 UTSW 6 103691674 missense probably benign 0.01
R7863:Chl1 UTSW 6 103706514 missense possibly damaging 0.46
R7874:Chl1 UTSW 6 103690263 missense probably benign 0.22
R7998:Chl1 UTSW 6 103729289 missense probably benign 0.01
R8044:Chl1 UTSW 6 103706632 missense probably damaging 0.96
R8059:Chl1 UTSW 6 103674987 missense probably damaging 0.97
R8462:Chl1 UTSW 6 103729169 missense probably benign 0.11
Z1177:Chl1 UTSW 6 103693096 nonsense probably null
Z1177:Chl1 UTSW 6 103697949 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCCTAGCTTACCAGCCACTGAGTC -3'
(R):5'- AAGGTCCAGGCACTTACTCCCTTC -3'

Sequencing Primer
(F):5'- GCCACTGAGTCTCATTCTGAAAAG -3'
(R):5'- ATTGGCTTTCCACAGCCTCT -3'
Posted On2014-06-06