Mutagenetix > Incidental Mutations

Incidental Mutation 'R0060:Chl1'

201403

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

038353-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.412) question?

Stock #

R0060 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 103711058 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

Predicted Effect

probably benign
Transcript: ENSMUST00000066905

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203830

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203912

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205098

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.0%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	A	C	11: 58,422,182		probably benign	Het
A630091E08Rik	A	G	7: 98,543,668		noncoding transcript	Het
Abca8a	T	C	11: 110,070,480	T539A	probably damaging	Het
Ankrd60	A	T	2: 173,572,613	M1K	probably null	Het
Arnt2	G	A	7: 84,347,530	R63C	probably damaging	Het
Cabcoco1	A	T	10: 68,533,862		probably null	Het
Capn7	T	C	14: 31,365,604		probably benign	Het
Cd109	G	A	9: 78,703,107	E1145K	probably damaging	Het
Celsr1	A	T	15: 85,922,198	V2353D	probably damaging	Het
Cep350	C	T	1: 155,928,626	D904N	probably damaging	Het
Colec10	G	A	15: 54,439,146		probably benign	Het
Cst11	T	A	2: 148,770,402	Q105L	probably damaging	Het
Eps8l3	T	C	3: 107,879,541	L11S	probably damaging	Het
Gsdme	A	G	6: 50,221,029	I317T	possibly damaging	Het
Itgad	T	C	7: 128,202,986	S979P	probably damaging	Het
Mga	T	C	2: 119,960,961		probably null	Het
Nubpl	T	C	12: 52,310,687		probably benign	Het
Olfr1105	T	C	2: 87,033,774	Y149C	probably damaging	Het
Olfr124	T	C	17: 37,806,000	L285P	probably damaging	Het
Pard3b	G	A	1: 61,639,315	E25K	probably damaging	Het
Phactr1	T	A	13: 42,682,721	Y8*	probably null	Het
Phf14	T	C	6: 11,953,317	S352P	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Prap1	G	T	7: 140,093,477		probably benign	Het
Prdm8	T	A	5: 98,185,260	F229I	probably benign	Het
Rfx6	T	C	10: 51,677,840	F11L	probably benign	Het
Rfx8	T	A	1: 39,718,405		probably benign	Het
Rif1	C	T	2: 52,111,117	R1528C	probably damaging	Het
Ripk4	G	A	16: 97,763,518		probably benign	Het
Satb1	T	A	17: 51,740,203	I695F	probably damaging	Het
Sema4d	A	G	13: 51,705,257		probably benign	Het
Slc30a4	T	A	2: 122,685,184	T381S	probably benign	Het
Suv39h2	T	C	2: 3,464,916	Y134C	probably damaging	Het
Tcerg1	C	T	18: 42,524,008	A185V	unknown	Het
Tep1	T	A	14: 50,866,029	D268V	probably damaging	Het
Tmem89	T	A	9: 108,915,417	V126D	probably damaging	Het
Trf	T	C	9: 103,220,922	T46A	probably benign	Het
Trmt6	C	T	2: 132,806,769	R415Q	possibly damaging	Het
Trp53bp1	T	C	2: 121,204,525	K1625E	probably damaging	Het
Zcchc4	T	A	5: 52,807,078	I292N	possibly damaging	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
R8462:Chl1	UTSW	6	103729169	missense	probably benign	0.11
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCTAGCTTACCAGCCACTGAGTC -3'
(R):5'- AAGGTCCAGGCACTTACTCCCTTC -3'

Sequencing Primer
(F):5'- GCCACTGAGTCTCATTCTGAAAAG -3'
(R):5'- ATTGGCTTTCCACAGCCTCT -3'

Posted On

2014-06-06