Incidental Mutation 'R0306:Ces1f'
ID201418
Institutional Source Beutler Lab
Gene Symbol Ces1f
Ensembl Gene ENSMUSG00000031725
Gene Namecarboxylesterase 1F
SynonymsTGH-2, CesML1
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0306 (G1)
Quality Score28
Status Validated
Chromosome8
Chromosomal Location93256236-93279747 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 93276544 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034178] [ENSMUST00000140026]
Predicted Effect probably benign
Transcript: ENSMUST00000034178
SMART Domains Protein: ENSMUSP00000034178
Gene: ENSMUSG00000031725

DomainStartEndE-ValueType
Pfam:COesterase 1 545 2.5e-166 PFAM
Pfam:Abhydrolase_3 136 244 4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133879
Predicted Effect probably benign
Transcript: ENSMUST00000140026
SMART Domains Protein: ENSMUSP00000116525
Gene: ENSMUSG00000031725

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Dytn G A 1: 63,685,113 P3S possibly damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Il15 T A 8: 82,334,454 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Parp14 A G 16: 35,856,574 L1008P probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Slc9a9 A T 9: 95,137,934 T519S probably benign Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Trpc4ap A G 2: 155,636,260 V662A probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Ces1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ces1f APN 8 93267992 missense probably benign
IGL01143:Ces1f APN 8 93271830 critical splice donor site probably null
IGL01571:Ces1f APN 8 93258368 missense probably benign 0.00
IGL01731:Ces1f APN 8 93267320 missense possibly damaging 0.73
IGL01733:Ces1f APN 8 93270014 missense probably damaging 1.00
IGL02124:Ces1f APN 8 93265860 missense possibly damaging 0.54
IGL03058:Ces1f APN 8 93269972 critical splice donor site probably null
IGL03124:Ces1f APN 8 93275384 missense probably benign
3-1:Ces1f UTSW 8 93275431 missense probably benign 0.29
G5030:Ces1f UTSW 8 93274219 missense probably benign 0.03
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0025:Ces1f UTSW 8 93271885 missense probably benign 0.27
R0113:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R0201:Ces1f UTSW 8 93267329 missense probably null 0.01
R0317:Ces1f UTSW 8 93263391 missense probably benign 0.05
R0558:Ces1f UTSW 8 93275389 missense probably benign
R0791:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R0833:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R0836:Ces1f UTSW 8 93270024 missense probably damaging 0.98
R1087:Ces1f UTSW 8 93258295 missense probably damaging 1.00
R1118:Ces1f UTSW 8 93267242 splice site probably benign
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1147:Ces1f UTSW 8 93258281 missense possibly damaging 0.89
R1183:Ces1f UTSW 8 93268005 missense probably benign 0.01
R1371:Ces1f UTSW 8 93279649 missense probably damaging 0.98
R1480:Ces1f UTSW 8 93274154 missense probably benign 0.07
R1522:Ces1f UTSW 8 93271889 missense possibly damaging 0.52
R1681:Ces1f UTSW 8 93275414 missense probably benign 0.00
R1865:Ces1f UTSW 8 93274265 splice site probably benign
R2437:Ces1f UTSW 8 93270139 splice site probably null
R3038:Ces1f UTSW 8 93256598 missense probably damaging 1.00
R4199:Ces1f UTSW 8 93256889 missense probably benign 0.00
R4406:Ces1f UTSW 8 93263322 missense probably benign
R5385:Ces1f UTSW 8 93265760 nonsense probably null
R5450:Ces1f UTSW 8 93265795 missense probably benign 0.04
R5627:Ces1f UTSW 8 93279699 start codon destroyed probably null 0.93
R6182:Ces1f UTSW 8 93256496 missense probably benign 0.43
R6256:Ces1f UTSW 8 93265794 missense probably damaging 1.00
R6379:Ces1f UTSW 8 93279651 missense probably benign
R6443:Ces1f UTSW 8 93275365 missense probably benign 0.00
R6967:Ces1f UTSW 8 93267997 missense probably benign 0.00
R7158:Ces1f UTSW 8 93268016 missense probably benign 0.00
R7323:Ces1f UTSW 8 93271844 missense probably damaging 1.00
R7654:Ces1f UTSW 8 93271934 missense probably benign 0.00
R7810:Ces1f UTSW 8 93256918 missense probably damaging 1.00
R7812:Ces1f UTSW 8 93258310 missense probably benign 0.00
R7864:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7947:Ces1f UTSW 8 93274141 missense possibly damaging 0.65
R7999:Ces1f UTSW 8 93262995 missense possibly damaging 0.77
X0026:Ces1f UTSW 8 93270056 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTTCTGGACAGCACAAGCACC -3'
(R):5'- AGCGATGCTCTGACAAGAAGGC -3'

Sequencing Primer
(F):5'- TAGCTAGGAAGGATGAACAGCC -3'
(R):5'- TGCTCTGACAAGAAGGCTATTAACC -3'
Posted On2014-06-06