Incidental Mutation 'R0306:Slc9a9'
ID201419
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission 038517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0306 (G1)
Quality Score38
Status Validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95137934 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 519 (T519S)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: T519S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: T519S

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,179,889 V270A probably damaging Het
BC028528 C T 3: 95,889,820 probably benign Het
Bspry T C 4: 62,496,157 F329S probably damaging Het
Cd209a A G 8: 3,745,535 Y120H probably benign Het
Ces1f T C 8: 93,276,544 probably benign Het
Cfap52 T C 11: 67,954,070 N58D probably benign Het
Cfap74 G A 4: 155,465,439 probably benign Het
Chst8 T C 7: 34,675,298 E372G probably benign Het
Ddx49 A G 8: 70,294,672 probably benign Het
Ddx52 G T 11: 83,944,648 L133F probably benign Het
Defb26 T A 2: 152,507,968 I131F unknown Het
Dip2c T A 13: 9,604,599 S719T probably benign Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Doxl2 T C 6: 48,976,086 V315A probably damaging Het
Dytn G A 1: 63,685,113 P3S possibly damaging Het
Fmn2 T C 1: 174,609,484 probably benign Het
Gal3st1 T A 11: 3,998,546 L251Q probably damaging Het
Gm19684 A T 17: 36,127,408 probably benign Het
Il15 T A 8: 82,334,454 probably benign Het
Jag1 C T 2: 137,085,935 G852D probably damaging Het
Kbtbd4 A G 2: 90,914,186 probably benign Het
Kdm3b C A 18: 34,804,017 Q451K probably benign Het
Lrfn2 A T 17: 49,096,255 I469F probably damaging Het
Mep1a A T 17: 43,502,643 probably benign Het
Morn5 T C 2: 36,054,974 F70S probably damaging Het
Nav2 C A 7: 49,545,903 P1009Q probably benign Het
Noc3l T C 19: 38,807,650 Y334C probably damaging Het
Nsun4 A T 4: 116,052,822 Y180* probably null Het
Nup210l T C 3: 90,207,368 I1750T probably benign Het
Olfr1044 T A 2: 86,171,716 I34F possibly damaging Het
Olfr473 A T 7: 107,933,700 Y60F probably damaging Het
Olfr571 A T 7: 102,909,803 I12N probably benign Het
Parp14 A G 16: 35,856,574 L1008P probably benign Het
Paxbp1 A G 16: 91,022,115 V759A possibly damaging Het
Prdm10 C A 9: 31,316,224 Q42K probably damaging Het
Prkcsh T C 9: 22,006,526 probably benign Het
Psmg1 A G 16: 95,987,340 C138R probably damaging Het
Ptprb T C 10: 116,343,988 M1437T probably benign Het
Ryr3 A G 2: 112,775,655 probably null Het
Serpinf1 T C 11: 75,413,935 Y200C probably damaging Het
Shox2 T C 3: 66,973,834 H130R probably damaging Het
Slc22a1 A G 17: 12,662,598 F335L probably benign Het
Slc44a5 A G 3: 154,270,001 N683S probably damaging Het
Smarca2 T A 19: 26,640,613 L348Q probably damaging Het
Sorbs1 T C 19: 40,344,411 D521G possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Srp19 T C 18: 34,334,576 probably benign Het
Stk35 T A 2: 129,801,763 Y222* probably null Het
Syt10 T G 15: 89,826,988 K114T probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Trpc4ap A G 2: 155,636,260 V662A probably benign Het
Ttll4 G A 1: 74,696,757 R1066Q probably benign Het
Tulp2 C T 7: 45,518,576 probably benign Het
Unc5b C A 10: 60,779,658 probably benign Het
Vmn1r230 T A 17: 20,846,633 I28K possibly damaging Het
Vmn2r118 A C 17: 55,608,616 F445V possibly damaging Het
Zfp142 C T 1: 74,570,182 E1485K probably damaging Het
Zfp819 C A 7: 43,617,197 A292E possibly damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCCTTGGACAGAAGCAGCTTTGAC -3'
(R):5'- TGGAGCCAGTGATCTCTAGCCAAC -3'

Sequencing Primer
(F):5'- CAGCTTTGACACTGATGGC -3'
(R):5'- AGTTCTTCAGCACCATACGATTTTG -3'
Posted On2014-06-06