Incidental Mutation 'R0090:Vmn2r72'
ID20142
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 038377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0090 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85754876 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 36 (I36V)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: I36V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I36V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.7%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4933427I04Rik A G 4: 123,860,982 T230A possibly damaging Het
9230110C19Rik T A 9: 8,027,183 N118I probably benign Het
Acsm1 T C 7: 119,662,189 probably benign Het
Acta1 T C 8: 123,893,657 N14S probably damaging Het
Aff4 A G 11: 53,392,782 T362A probably benign Het
Aggf1 A G 13: 95,364,959 I305T probably benign Het
Ap4b1 A G 3: 103,820,429 D325G possibly damaging Het
Ap4e1 C T 2: 127,064,985 T1055I possibly damaging Het
Arhgef2 A T 3: 88,639,348 Q496L probably damaging Het
Arhgef28 A G 13: 98,075,110 F122L probably damaging Het
Baiap3 G A 17: 25,250,070 probably benign Het
Casp8ap2 T A 4: 32,640,327 H460Q probably damaging Het
Casz1 A G 4: 148,933,411 T386A probably benign Het
Cd53 A T 3: 106,767,409 V114E possibly damaging Het
Celsr2 A G 3: 108,393,327 probably benign Het
Chaf1b G T 16: 93,887,124 A88S possibly damaging Het
Cldn10 A T 14: 118,874,200 Y194F probably damaging Het
Clec2e A C 6: 129,095,218 probably null Het
Cmpk2 A T 12: 26,478,022 T413S probably benign Het
Col9a1 T A 1: 24,223,562 probably null Het
Dchs1 G T 7: 105,755,932 Q2468K probably benign Het
Ddx60 A G 8: 61,942,293 D88G probably damaging Het
Dnah8 A G 17: 30,784,090 R3588G probably benign Het
Ect2 C T 3: 27,138,502 E431K probably null Het
Ect2 T C 3: 27,115,476 T774A probably benign Het
Ern1 A G 11: 106,405,823 V767A probably damaging Het
Fbln1 A C 15: 85,224,288 E75A possibly damaging Het
Fgf5 C T 5: 98,261,987 R132* probably null Het
Folh1 T C 7: 86,725,868 probably benign Het
Gdf15 A T 8: 70,629,684 H257Q probably damaging Het
Ghitm T C 14: 37,122,219 T322A probably benign Het
Gm13212 A T 4: 145,622,625 K211* probably null Het
Gm5709 A G 3: 59,618,771 noncoding transcript Het
Hbb-y C T 7: 103,852,743 probably null Het
Hmcn2 A T 2: 31,426,198 D3771V probably damaging Het
Hspa12a T C 19: 58,799,509 D627G probably benign Het
Idh2 T C 7: 80,097,914 E286G probably damaging Het
Idh3b C A 2: 130,280,979 A297S probably benign Het
Igsf3 A G 3: 101,435,652 E535G probably damaging Het
Ilf3 T A 9: 21,395,414 D314E probably damaging Het
Itgb8 A G 12: 119,202,563 S78P probably benign Het
Itih5 G A 2: 10,164,684 V31I probably benign Het
Kcnj2 T C 11: 111,073,027 V415A probably benign Het
Kin A G 2: 10,085,773 Q53R possibly damaging Het
Krt78 A T 15: 101,947,837 M513K probably benign Het
Krtap4-8 A T 11: 99,780,486 probably benign Het
Ltbr T C 6: 125,309,449 probably benign Het
Mgat4a G A 1: 37,490,333 T146I probably damaging Het
Mrps2 G C 2: 28,468,256 W19C probably damaging Het
Mthfs T C 9: 89,211,291 S33P probably damaging Het
Myh6 T C 14: 54,958,704 D546G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndst2 T C 14: 20,727,267 T553A probably damaging Het
Nlrp12 T C 7: 3,240,034 E616G probably damaging Het
Nrde2 T C 12: 100,129,286 probably benign Het
Nup210l G A 3: 90,211,779 V1832I probably benign Het
Olfr1283 A T 2: 111,369,294 I221F probably damaging Het
Olfr376 G A 11: 73,375,576 V276I probably benign Het
Pcm1 A T 8: 41,256,041 E9D probably damaging Het
Pear1 A T 3: 87,754,342 D541E possibly damaging Het
Peg10 A G 6: 4,756,063 probably benign Het
Prss1 G A 6: 41,461,232 R31Q probably benign Het
Ptpn13 T C 5: 103,569,503 V1837A probably damaging Het
Rasgrp3 A G 17: 75,498,461 D149G probably damaging Het
Reg3d A T 6: 78,378,483 H8Q possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Sacs T A 14: 61,205,440 L1645H probably damaging Het
Slc16a5 A T 11: 115,464,925 S71C probably damaging Het
Slc9a3 A G 13: 74,158,728 E324G probably damaging Het
Smgc T C 15: 91,859,762 V574A possibly damaging Het
Stac3 C T 10: 127,503,930 probably benign Het
Supv3l1 A G 10: 62,429,706 L685P probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tas2r125 G T 6: 132,910,398 A250S probably benign Het
Tdrd6 C T 17: 43,628,241 V639I probably benign Het
Thap12 T G 7: 98,715,893 W423G probably damaging Het
Tmem245 T C 4: 56,899,410 I217V probably benign Het
Trip12 T A 1: 84,732,136 probably benign Het
Tshz3 T C 7: 36,768,892 V102A probably benign Het
Ubap1 T C 4: 41,379,826 S347P probably damaging Het
Usp10 C T 8: 119,953,196 Q612* probably null Het
Vps37a T C 8: 40,526,989 I63T possibly damaging Het
Whrn C A 4: 63,432,732 R9L possibly damaging Het
Xrcc1 T C 7: 24,570,217 Y401H probably damaging Het
Ylpm1 GCCTAAGCAGCAACCTAAG GCCTAAG 12: 85,029,040 probably benign Het
Zfhx3 G A 8: 108,950,057 D2580N possibly damaging Het
Zfhx4 A G 3: 5,243,625 N637S probably damaging Het
Zyg11a A T 4: 108,201,347 probably benign Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R7843:Vmn2r72 UTSW 7 85749630 missense probably benign 0.01
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGCAATTATGGGAGTCTCTCTGC -3'
(R):5'- TGATCTCAGATGCCGAGCCTAAGG -3'

Sequencing Primer
(F):5'- GCAAGGTCAATACCGTGTTTC -3'
(R):5'- CATTTGTCCTTTAGCAGTAGGTACAG -3'
Posted On2013-04-11