Incidental Mutation 'R0082:Klra8'
ID 201428
Institutional Source Beutler Lab
Gene Symbol Klra8
Ensembl Gene ENSMUSG00000089727
Gene Name killer cell lectin-like receptor, subfamily A, member 8
Synonyms Ly49u<129>, Ly49h, Cmv1, Cmv-1
MMRRC Submission 038369-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R0082 (G1)
Quality Score 130
Status Validated
Chromosome 6
Chromosomal Location 130092189-130106861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130102018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000014476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014476]
AlphaFold Q60682
PDB Structure Crystal structure of the activating Ly49H receptor in complex with m157 (G1F strain) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000014476
AA Change: D139G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014476
Gene: ENSMUSG00000089727
AA Change: D139G

DomainStartEndE-ValueType
Blast:CLECT 73 124 9e-8 BLAST
CLECT 143 258 6.53e-15 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype PHENOTYPE: Most mouse strains other than C57BL/6 and C57BL/10 lack this gene and this correlates with an increased susceptiblity to CMV infection. A congenic strain in which the CMV resistant allele from C57BL/6 mice has been introduced in the BALB/c background shows high susceptibility to malarial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A C 12: 21,379,049 (GRCm39) probably benign Het
Adcy1 T C 11: 7,099,497 (GRCm39) probably benign Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Ankrd33b T C 15: 31,297,935 (GRCm39) N274S probably benign Het
Antkmt T C 17: 26,010,548 (GRCm39) I89V probably benign Het
Arhgef1 C T 7: 24,612,030 (GRCm39) Q100* probably null Het
Ccdc180 A G 4: 45,896,205 (GRCm39) D118G probably null Het
Cdh23 T C 10: 60,148,366 (GRCm39) D2667G probably damaging Het
Cdh4 A T 2: 179,535,981 (GRCm39) N844I possibly damaging Het
Cep57 T C 9: 13,722,172 (GRCm39) probably benign Het
Dnah7a A T 1: 53,557,867 (GRCm39) D2182E probably damaging Het
Dync1h1 A G 12: 110,602,880 (GRCm39) T2174A probably benign Het
Eef1akmt2 T A 7: 132,453,201 (GRCm39) R44* probably null Het
Evpl T A 11: 116,125,829 (GRCm39) I43F probably damaging Het
F13a1 G T 13: 37,172,927 (GRCm39) P151Q probably damaging Het
Galnt5 A T 2: 57,889,047 (GRCm39) I216F possibly damaging Het
Glt6d1 C A 2: 25,684,739 (GRCm39) probably null Het
Gpr139 T A 7: 118,744,268 (GRCm39) T106S probably benign Het
Hoatz T C 9: 51,013,102 (GRCm39) T57A probably benign Het
Hoxb3 A G 11: 96,235,097 (GRCm39) D8G probably damaging Het
Hpse T C 5: 100,840,128 (GRCm39) K330E possibly damaging Het
Kcmf1 G T 6: 72,827,470 (GRCm39) probably null Het
Klra2 T C 6: 131,197,210 (GRCm39) N263S possibly damaging Het
Lrrc46 A C 11: 96,931,903 (GRCm39) probably benign Het
Ly86 A T 13: 37,602,513 (GRCm39) probably null Het
Mmp20 C T 9: 7,642,808 (GRCm39) T214M probably benign Het
Or4k5 A T 14: 50,385,512 (GRCm39) I273K probably damaging Het
Or52s1b G T 7: 102,822,409 (GRCm39) A145E probably benign Het
Or6c1b T C 10: 129,273,140 (GRCm39) I153T possibly damaging Het
Or6c209 G A 10: 129,483,522 (GRCm39) C175Y probably benign Het
Pigg A G 5: 108,460,751 (GRCm39) probably benign Het
Polq C A 16: 36,837,619 (GRCm39) T177K probably benign Het
Pomgnt2 A T 9: 121,811,326 (GRCm39) V485E probably damaging Het
Ppip5k2 A T 1: 97,687,057 (GRCm39) C49* probably null Het
Prkrip1 T C 5: 136,226,682 (GRCm39) N53D possibly damaging Het
Prrc2b T C 2: 32,102,310 (GRCm39) probably benign Het
Qprt T C 7: 126,707,358 (GRCm39) E246G probably damaging Het
Rpl9 A G 5: 65,545,995 (GRCm39) V167A probably benign Het
Rskr T C 11: 78,184,384 (GRCm39) S244P probably damaging Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sgsm1 T C 5: 113,436,702 (GRCm39) I43V probably benign Het
Slc38a7 A G 8: 96,567,109 (GRCm39) probably benign Het
Slc8b1 A G 5: 120,662,265 (GRCm39) probably benign Het
Sp2 T C 11: 96,852,525 (GRCm39) Y133C probably damaging Het
Spdye4b A T 5: 143,181,430 (GRCm39) D95V probably damaging Het
Srek1 T C 13: 103,880,194 (GRCm39) T455A unknown Het
Stox2 A T 8: 47,656,317 (GRCm39) probably benign Het
Synrg T A 11: 83,878,736 (GRCm39) probably benign Het
Tie1 T A 4: 118,341,550 (GRCm39) E254V probably damaging Het
Tmem97 G T 11: 78,433,414 (GRCm39) F160L probably damaging Het
Utp6 A T 11: 79,844,457 (GRCm39) H189Q possibly damaging Het
Vip T A 10: 5,594,953 (GRCm39) *172R probably null Het
Wdr91 T C 6: 34,883,620 (GRCm39) R132G possibly damaging Het
Wipi1 T C 11: 109,469,110 (GRCm39) probably benign Het
Zfp445 A G 9: 122,681,421 (GRCm39) V840A probably damaging Het
Other mutations in Klra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Klra8 APN 6 130,092,561 (GRCm39) missense probably benign
IGL01786:Klra8 APN 6 130,096,031 (GRCm39) critical splice acceptor site probably null
IGL02145:Klra8 APN 6 130,102,199 (GRCm39) missense probably benign 0.01
IGL02531:Klra8 APN 6 130,095,933 (GRCm39) missense possibly damaging 0.67
P4748:Klra8 UTSW 6 130,099,007 (GRCm39) missense possibly damaging 0.51
R0853:Klra8 UTSW 6 130,095,977 (GRCm39) missense probably damaging 1.00
R1517:Klra8 UTSW 6 130,092,603 (GRCm39) missense probably benign 0.02
R1610:Klra8 UTSW 6 130,095,981 (GRCm39) missense probably damaging 1.00
R1669:Klra8 UTSW 6 130,092,592 (GRCm39) nonsense probably null
R2015:Klra8 UTSW 6 130,092,536 (GRCm39) missense probably damaging 1.00
R3784:Klra8 UTSW 6 130,102,018 (GRCm39) missense probably benign 0.02
R6909:Klra8 UTSW 6 130,102,123 (GRCm39) missense probably benign 0.03
R7009:Klra8 UTSW 6 130,102,147 (GRCm39) missense probably benign 0.02
R8443:Klra8 UTSW 6 130,105,056 (GRCm39) missense probably damaging 0.98
R9055:Klra8 UTSW 6 130,096,017 (GRCm39) missense probably benign 0.00
X0013:Klra8 UTSW 6 130,102,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATTCACCGTGACACTGACAGAATTG -3'
(R):5'- GCAGCAACATGCAAAGGGATTTCAAC -3'

Sequencing Primer
(F):5'- GAGTGCCAAAGAGAACTTTCCTTC -3'
(R):5'- CATGCAAAGGGATTTCAACTTAAAGG -3'
Posted On 2014-06-10