Mutagenetix > Incidental Mutation

Incidental Mutation 'R0068:Rusc2'

201436

Institutional Source

Beutler Lab

Gene Symbol

Rusc2

Ensembl Gene

ENSMUSG00000035969

Gene Name

RUN and SH3 domain containing 2

Synonyms

MMRRC Submission

038359-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R0068 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

43381979-43427088 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 43424100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000173682] [ENSMUST00000171134] [ENSMUST00000149676]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035645

SMART Domains

Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052829

SMART Domains

Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	47	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098106

SMART Domains

Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC
SH3	1457	1512	7.4e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107928

SMART Domains

Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	1.3e-20	PFAM
Pfam:DUF2475	212	251	6.9e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107929

SMART Domains

Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	1.5e-20	PFAM
Pfam:DUF2475	232	271	7.7e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125393

Predicted Effect

probably benign
Transcript: ENSMUST00000131668

SMART Domains

Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	600	617	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC
RUN	1109	1177	3.66e-21	SMART
low complexity region	1235	1260	N/A	INTRINSIC
low complexity region	1289	1324	N/A	INTRINSIC
low complexity region	1330	1341	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146710

Predicted Effect

probably benign
Transcript: ENSMUST00000149221

Predicted Effect

probably benign
Transcript: ENSMUST00000173682

SMART Domains

Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

Domain	Start	End	E-Value	Type
low complexity region	39	47	N/A	INTRINSIC
low complexity region	212	230	N/A	INTRINSIC
low complexity region	253	265	N/A	INTRINSIC
low complexity region	411	427	N/A	INTRINSIC
low complexity region	435	448	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	685	703	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154754

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149556

Predicted Effect

probably benign
Transcript: ENSMUST00000155080

Predicted Effect

probably benign
Transcript: ENSMUST00000171134

SMART Domains

Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

Domain	Start	End	E-Value	Type
Pfam:DUF2475	15	76	7.2e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149676

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 92.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,952,221	T1675A	probably benign	Het
Abca6	T	C	11: 110,182,882	T1448A	probably damaging	Het
Aldoart2	G	T	12: 55,565,448	E53*	probably null	Het
Ankra2	C	T	13: 98,273,383	Q137*	probably null	Het
Arpc1a	C	T	5: 145,091,244	T21I	possibly damaging	Het
Arvcf	T	C	16: 18,396,954		probably benign	Het
Ash1l	C	A	3: 89,007,317	S1751R	probably benign	Het
Bsn	C	A	9: 108,112,137	G2139C	probably damaging	Het
Ccdc148	T	C	2: 58,827,617	E530G	probably benign	Het
Cct3	A	G	3: 88,318,465	D365G	probably benign	Het
Chd2	A	T	7: 73,484,534	S688R	probably damaging	Het
Crispld1	A	G	1: 17,752,988	T398A	possibly damaging	Het
Ctbp2	A	C	7: 132,990,059	V906G	possibly damaging	Het
Cwf19l1	A	T	19: 44,131,499	Y68N	probably damaging	Het
Dlc1	T	A	8: 36,937,721	M305L	probably benign	Het
Dnm1l	C	A	16: 16,324,019	G288C	probably damaging	Het
Fignl2	A	T	15: 101,054,248	I51N	probably damaging	Het
Flnb	A	G	14: 7,915,290	N1474D	possibly damaging	Het
Ghrhr	C	T	6: 55,380,864		probably benign	Het
Gm11639	T	C	11: 104,720,822	S497P	probably benign	Het
Hltf	G	A	3: 20,059,090	R9H	probably damaging	Het
Hps5	A	G	7: 46,777,042		probably benign	Het
Itpr3	T	C	17: 27,104,060		probably benign	Het
Kansl1l	A	G	1: 66,720,888	V911A	probably benign	Het
Kdm3b	C	T	18: 34,824,774	T1064I	probably benign	Het
Lrriq1	T	A	10: 103,063,418	Q1654L	probably benign	Het
Ltbp1	A	G	17: 75,359,409	T1366A	probably damaging	Het
Mroh1	A	G	15: 76,446,692		probably benign	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Napb	G	A	2: 148,698,923		probably benign	Het
Npc1	G	C	18: 12,208,367	P532A	probably benign	Het
Nrp2	G	T	1: 62,745,377	K228N	possibly damaging	Het
Olfr275	T	A	4: 52,825,503	Y35*	probably null	Het
Plekhg1	A	T	10: 3,940,504	K241*	probably null	Het
Poln	T	C	5: 34,077,088		probably benign	Het
Ppil1	A	T	17: 29,252,256	F92I	probably damaging	Het
Ppp1r9b	T	G	11: 95,001,220	F154V	probably damaging	Het
Ptchd3	T	G	11: 121,842,972	L896R	probably damaging	Het
Rev3l	A	G	10: 39,824,831	N1775D	possibly damaging	Het
Selenbp2	T	C	3: 94,703,509	V294A	probably benign	Het
Slc25a48	T	C	13: 56,451,211	V118A	probably damaging	Het
Slc38a10	T	C	11: 120,134,853	D219G	probably damaging	Het
Slc38a2	C	T	15: 96,691,292		probably null	Het
Slc39a12	A	G	2: 14,435,678	E480G	probably benign	Het
Tab2	C	A	10: 7,919,677	R347L	probably damaging	Het
Tas2r123	T	C	6: 132,847,992	I284T	possibly damaging	Het
Tnks1bp1	T	A	2: 85,062,352	D212E	probably benign	Het
Trim67	T	C	8: 124,794,568	V223A	probably damaging	Het
Ugcg	A	G	4: 59,217,130	D218G	probably benign	Het
Vmn2r59	A	G	7: 42,046,301	L229S	probably damaging	Het
Zfp451	A	T	1: 33,777,625	L198I	probably damaging	Het

Other mutations in Rusc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01358:Rusc2	APN	4	43426116	missense	probably damaging	0.97
IGL01474:Rusc2	APN	4	43416434	missense	probably damaging	0.98
IGL01541:Rusc2	APN	4	43415840	missense	probably benign	0.08
IGL01628:Rusc2	APN	4	43425729	missense	probably damaging	1.00
IGL01969:Rusc2	APN	4	43415738	missense	probably benign	0.02
IGL02030:Rusc2	APN	4	43416095	missense	possibly damaging	0.86
IGL02079:Rusc2	APN	4	43425668	missense	probably benign
IGL02115:Rusc2	APN	4	43426136	splice site	probably benign
IGL02122:Rusc2	APN	4	43421685	missense	possibly damaging	0.67
IGL02350:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02357:Rusc2	APN	4	43425351	missense	possibly damaging	0.86
IGL02437:Rusc2	APN	4	43415545	missense	probably damaging	1.00
IGL02930:Rusc2	APN	4	43416376	missense	probably damaging	0.99
IGL03154:Rusc2	APN	4	43425806	missense	probably benign	0.00
P0026:Rusc2	UTSW	4	43415840	missense	possibly damaging	0.93
R0036:Rusc2	UTSW	4	43424009	missense	probably damaging	1.00
R0068:Rusc2	UTSW	4	43424100	splice site	probably benign
R0114:Rusc2	UTSW	4	43422055	missense	probably damaging	1.00
R0255:Rusc2	UTSW	4	43423954	missense	probably damaging	1.00
R0471:Rusc2	UTSW	4	43425486	missense	probably damaging	0.99
R1381:Rusc2	UTSW	4	43416137	missense	probably damaging	1.00
R1413:Rusc2	UTSW	4	43416568	missense	probably benign	0.00
R1416:Rusc2	UTSW	4	43421617	missense	possibly damaging	0.86
R1731:Rusc2	UTSW	4	43426046	missense	probably benign
R1864:Rusc2	UTSW	4	43421719	missense	possibly damaging	0.49
R1897:Rusc2	UTSW	4	43421749	missense	probably damaging	1.00
R2010:Rusc2	UTSW	4	43415212	missense	probably benign	0.06
R2212:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R2275:Rusc2	UTSW	4	43416260	missense	probably damaging	1.00
R2885:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R2886:Rusc2	UTSW	4	43415456	missense	probably benign	0.28
R3412:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3413:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3414:Rusc2	UTSW	4	43415935	missense	probably damaging	1.00
R3852:Rusc2	UTSW	4	43416424	missense	probably benign	0.45
R4135:Rusc2	UTSW	4	43425563	missense	possibly damaging	0.49
R4272:Rusc2	UTSW	4	43415533	missense	probably damaging	1.00
R4574:Rusc2	UTSW	4	43416080	missense	probably damaging	0.99
R4888:Rusc2	UTSW	4	43423942	missense	probably damaging	1.00
R5010:Rusc2	UTSW	4	43415926	missense	probably damaging	1.00
R5071:Rusc2	UTSW	4	43415240	missense	probably benign	0.05
R5131:Rusc2	UTSW	4	43414948	missense	probably benign	0.03
R5177:Rusc2	UTSW	4	43421805	splice site	probably null
R5540:Rusc2	UTSW	4	43423975	missense	probably damaging	1.00
R5561:Rusc2	UTSW	4	43415932	nonsense	probably null
R5628:Rusc2	UTSW	4	43425348	missense	probably damaging	1.00
R5645:Rusc2	UTSW	4	43425758	missense	probably benign	0.06
R6129:Rusc2	UTSW	4	43424271	missense	probably damaging	1.00
R6362:Rusc2	UTSW	4	43416416	missense	probably benign	0.30
R6633:Rusc2	UTSW	4	43414852	missense	probably damaging	0.99
R6980:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R7491:Rusc2	UTSW	4	43426528	missense	probably damaging	1.00
R7641:Rusc2	UTSW	4	43425335	missense	possibly damaging	0.84
R7698:Rusc2	UTSW	4	43414900	nonsense	probably null
R7710:Rusc2	UTSW	4	43416119	missense	probably benign	0.07
R8052:Rusc2	UTSW	4	43421851	missense	probably benign
R8061:Rusc2	UTSW	4	43422492	missense	probably damaging	1.00
R8127:Rusc2	UTSW	4	43423747	missense	possibly damaging	0.54
R8319:Rusc2	UTSW	4	43425378	missense	probably damaging	1.00
R8355:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8397:Rusc2	UTSW	4	43424206	missense	possibly damaging	0.95
R8455:Rusc2	UTSW	4	43422846	missense	probably benign	0.35
R8553:Rusc2	UTSW	4	43416508	missense	probably benign	0.05
R8725:Rusc2	UTSW	4	43401351	intron	probably benign
R8725:Rusc2	UTSW	4	43415396	missense	probably damaging	0.99
R8727:Rusc2	UTSW	4	43401351	intron	probably benign
R8834:Rusc2	UTSW	4	43416431	missense	possibly damaging	0.94
R9295:Rusc2	UTSW	4	43416382	missense	probably damaging	0.98
R9483:Rusc2	UTSW	4	43415897	missense	probably damaging	0.97
R9666:Rusc2	UTSW	4	43416262	missense	probably benign	0.21
R9705:Rusc2	UTSW	4	43424936	missense	probably benign	0.00
X0025:Rusc2	UTSW	4	43422226	missense	probably benign	0.00
X0066:Rusc2	UTSW	4	43422204	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCAACAGTTCTGTGAGCCCCAATG -3'
(R):5'- CCCCTGAGAGGAAGCAAAGCTATG -3'

Sequencing Primer
(F):5'- AATGTCGGCCACCTGGTTC -3'
(R):5'- TGCACTCACTTGAGCAGGC -3'

Posted On

2014-06-10