Incidental Mutation 'R0068:Ppil1'
ID201448
Institutional Source Beutler Lab
Gene Symbol Ppil1
Ensembl Gene ENSMUSG00000024007
Gene Namepeptidylprolyl isomerase (cyclophilin)-like 1
SynonymsCypl1, 1110060O10Rik
MMRRC Submission 038359-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R0068 (G1)
Quality Score77
Status Validated
Chromosome17
Chromosomal Location29250803-29264158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29252256 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 92 (F92I)
Ref Sequence ENSEMBL: ENSMUSP00000024802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024802] [ENSMUST00000135123]
Predicted Effect probably damaging
Transcript: ENSMUST00000024802
AA Change: F92I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024802
Gene: ENSMUSG00000024007
AA Change: F92I

DomainStartEndE-ValueType
Pfam:Pro_isomerase 13 163 5.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135123
SMART Domains Protein: ENSMUSP00000115705
Gene: ENSMUSG00000024007

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136811
Meta Mutation Damage Score 0.5652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cyclophilin family of peptidylprolyl isomerases (PPIases). The cyclophilins are a highly conserved, ubiquitous family, members of which play an important role in protein folding, immunosuppression by cyclosporin A, and infection of HIV-1 virions. Based on similarity to other PPIases, this protein could accelerate the folding of proteins and might catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,952,221 T1675A probably benign Het
Abca6 T C 11: 110,182,882 T1448A probably damaging Het
Aldoart2 G T 12: 55,565,448 E53* probably null Het
Ankra2 C T 13: 98,273,383 Q137* probably null Het
Arpc1a C T 5: 145,091,244 T21I possibly damaging Het
Arvcf T C 16: 18,396,954 probably benign Het
Ash1l C A 3: 89,007,317 S1751R probably benign Het
Bsn C A 9: 108,112,137 G2139C probably damaging Het
Ccdc148 T C 2: 58,827,617 E530G probably benign Het
Cct3 A G 3: 88,318,465 D365G probably benign Het
Chd2 A T 7: 73,484,534 S688R probably damaging Het
Crispld1 A G 1: 17,752,988 T398A possibly damaging Het
Ctbp2 A C 7: 132,990,059 V906G possibly damaging Het
Cwf19l1 A T 19: 44,131,499 Y68N probably damaging Het
Dlc1 T A 8: 36,937,721 M305L probably benign Het
Dnm1l C A 16: 16,324,019 G288C probably damaging Het
Fignl2 A T 15: 101,054,248 I51N probably damaging Het
Flnb A G 14: 7,915,290 N1474D possibly damaging Het
Ghrhr C T 6: 55,380,864 probably benign Het
Gm11639 T C 11: 104,720,822 S497P probably benign Het
Hltf G A 3: 20,059,090 R9H probably damaging Het
Hps5 A G 7: 46,777,042 probably benign Het
Itpr3 T C 17: 27,104,060 probably benign Het
Kansl1l A G 1: 66,720,888 V911A probably benign Het
Kdm3b C T 18: 34,824,774 T1064I probably benign Het
Lrriq1 T A 10: 103,063,418 Q1654L probably benign Het
Ltbp1 A G 17: 75,359,409 T1366A probably damaging Het
Mroh1 A G 15: 76,446,692 probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Napb G A 2: 148,698,923 probably benign Het
Npc1 G C 18: 12,208,367 P532A probably benign Het
Nrp2 G T 1: 62,745,377 K228N possibly damaging Het
Olfr275 T A 4: 52,825,503 Y35* probably null Het
Plekhg1 A T 10: 3,940,504 K241* probably null Het
Poln T C 5: 34,077,088 probably benign Het
Ppp1r9b T G 11: 95,001,220 F154V probably damaging Het
Ptchd3 T G 11: 121,842,972 L896R probably damaging Het
Rev3l A G 10: 39,824,831 N1775D possibly damaging Het
Rusc2 T C 4: 43,424,100 probably benign Het
Selenbp2 T C 3: 94,703,509 V294A probably benign Het
Slc25a48 T C 13: 56,451,211 V118A probably damaging Het
Slc38a10 T C 11: 120,134,853 D219G probably damaging Het
Slc38a2 C T 15: 96,691,292 probably null Het
Slc39a12 A G 2: 14,435,678 E480G probably benign Het
Tab2 C A 10: 7,919,677 R347L probably damaging Het
Tas2r123 T C 6: 132,847,992 I284T possibly damaging Het
Tnks1bp1 T A 2: 85,062,352 D212E probably benign Het
Trim67 T C 8: 124,794,568 V223A probably damaging Het
Ugcg A G 4: 59,217,130 D218G probably benign Het
Vmn2r59 A G 7: 42,046,301 L229S probably damaging Het
Zfp451 A T 1: 33,777,625 L198I probably damaging Het
Other mutations in Ppil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ppil1 APN 17 29251701 missense probably damaging 1.00
IGL01305:Ppil1 APN 17 29263888 missense possibly damaging 0.55
IGL01638:Ppil1 APN 17 29261792 missense probably benign 0.09
IGL01854:Ppil1 APN 17 29263888 missense possibly damaging 0.55
IGL03367:Ppil1 APN 17 29252244 splice site probably benign
ANU22:Ppil1 UTSW 17 29263888 missense possibly damaging 0.55
R0068:Ppil1 UTSW 17 29252256 missense probably damaging 0.98
R1716:Ppil1 UTSW 17 29261835 missense possibly damaging 0.94
R6597:Ppil1 UTSW 17 29261878 missense probably benign 0.01
R6598:Ppil1 UTSW 17 29261878 missense probably benign 0.01
R7880:Ppil1 UTSW 17 29261788 missense probably damaging 1.00
R7963:Ppil1 UTSW 17 29261788 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTAAGGACTCTCAAGAGGCAC -3'
(R):5'- CTTACCTGCATGAGGTTAGCGACTG -3'

Sequencing Primer
(F):5'- GACTCTCAAGAGGCACTGTTC -3'
(R):5'- ATAATGTGTCTACTGGGGGTTG -3'
Posted On2014-06-10