Mutagenetix > Incidental Mutations

Incidental Mutation 'R0068:Npc1'

201449

Institutional Source

Beutler Lab

Gene Symbol

Npc1

Ensembl Gene

ENSMUSG00000024413

Gene Name

NPC intracellular cholesterol transporter 1

Synonyms

nmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd

MMRRC Submission

038359-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.564) question?

Stock #

R0068 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

12189693-12236400 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 12208367 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 532 (P532A)

Ref Sequence

ENSEMBL: ENSMUSP00000025279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025279]

Predicted Effect

probably benign
Transcript: ENSMUST00000025279
AA Change: P532A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: P532A

Domain	Start	End	E-Value	Type
low complexity region	8	15	N/A	INTRINSIC
Pfam:NPC1_N	22	267	1.6e-79	PFAM
transmembrane domain	269	291	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
Pfam:Patched	436	896	3.5e-52	PFAM
Pfam:MMPL	648	794	6.3e-8	PFAM
Pfam:Sterol-sensing	649	803	2.7e-56	PFAM
Pfam:Patched	1023	1252	2.9e-33	PFAM
low complexity region	1259	1273	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145771

Meta Mutation Damage Score

0.2178

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 92.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,952,221	T1675A	probably benign	Het
Abca6	T	C	11: 110,182,882	T1448A	probably damaging	Het
Aldoart2	G	T	12: 55,565,448	E53*	probably null	Het
Ankra2	C	T	13: 98,273,383	Q137*	probably null	Het
Arpc1a	C	T	5: 145,091,244	T21I	possibly damaging	Het
Arvcf	T	C	16: 18,396,954		probably benign	Het
Ash1l	C	A	3: 89,007,317	S1751R	probably benign	Het
Bsn	C	A	9: 108,112,137	G2139C	probably damaging	Het
Ccdc148	T	C	2: 58,827,617	E530G	probably benign	Het
Cct3	A	G	3: 88,318,465	D365G	probably benign	Het
Chd2	A	T	7: 73,484,534	S688R	probably damaging	Het
Crispld1	A	G	1: 17,752,988	T398A	possibly damaging	Het
Ctbp2	A	C	7: 132,990,059	V906G	possibly damaging	Het
Cwf19l1	A	T	19: 44,131,499	Y68N	probably damaging	Het
Dlc1	T	A	8: 36,937,721	M305L	probably benign	Het
Dnm1l	C	A	16: 16,324,019	G288C	probably damaging	Het
Fignl2	A	T	15: 101,054,248	I51N	probably damaging	Het
Flnb	A	G	14: 7,915,290	N1474D	possibly damaging	Het
Ghrhr	C	T	6: 55,380,864		probably benign	Het
Gm11639	T	C	11: 104,720,822	S497P	probably benign	Het
Hltf	G	A	3: 20,059,090	R9H	probably damaging	Het
Hps5	A	G	7: 46,777,042		probably benign	Het
Itpr3	T	C	17: 27,104,060		probably benign	Het
Kansl1l	A	G	1: 66,720,888	V911A	probably benign	Het
Kdm3b	C	T	18: 34,824,774	T1064I	probably benign	Het
Lrriq1	T	A	10: 103,063,418	Q1654L	probably benign	Het
Ltbp1	A	G	17: 75,359,409	T1366A	probably damaging	Het
Mroh1	A	G	15: 76,446,692		probably benign	Het
Mroh2a	GT	GTT	1: 88,256,166		probably null	Het
Napb	G	A	2: 148,698,923		probably benign	Het
Nrp2	G	T	1: 62,745,377	K228N	possibly damaging	Het
Olfr275	T	A	4: 52,825,503	Y35*	probably null	Het
Plekhg1	A	T	10: 3,940,504	K241*	probably null	Het
Poln	T	C	5: 34,077,088		probably benign	Het
Ppil1	A	T	17: 29,252,256	F92I	probably damaging	Het
Ppp1r9b	T	G	11: 95,001,220	F154V	probably damaging	Het
Ptchd3	T	G	11: 121,842,972	L896R	probably damaging	Het
Rev3l	A	G	10: 39,824,831	N1775D	possibly damaging	Het
Rusc2	T	C	4: 43,424,100		probably benign	Het
Selenbp2	T	C	3: 94,703,509	V294A	probably benign	Het
Slc25a48	T	C	13: 56,451,211	V118A	probably damaging	Het
Slc38a10	T	C	11: 120,134,853	D219G	probably damaging	Het
Slc38a2	C	T	15: 96,691,292		probably null	Het
Slc39a12	A	G	2: 14,435,678	E480G	probably benign	Het
Tab2	C	A	10: 7,919,677	R347L	probably damaging	Het
Tas2r123	T	C	6: 132,847,992	I284T	possibly damaging	Het
Tnks1bp1	T	A	2: 85,062,352	D212E	probably benign	Het
Trim67	T	C	8: 124,794,568	V223A	probably damaging	Het
Ugcg	A	G	4: 59,217,130	D218G	probably benign	Het
Vmn2r59	A	G	7: 42,046,301	L229S	probably damaging	Het
Zfp451	A	T	1: 33,777,625	L198I	probably damaging	Het

Other mutations in Npc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02347:Npc1	APN	18	12199634	missense	probably benign	0.45
IGL02523:Npc1	APN	18	12201572	missense	probably benign	0.00
IGL03018:Npc1	APN	18	12214379	missense	probably damaging	0.99
IGL03101:Npc1	APN	18	12198539	missense	probably benign	0.15
IGL03151:Npc1	APN	18	12219275	missense	probably benign	0.05
IGL03377:Npc1	APN	18	12211821	missense	probably benign
PIT4354001:Npc1	UTSW	18	12211535	missense	probably benign	0.00
R0068:Npc1	UTSW	18	12208367	missense	probably benign	0.04
R0190:Npc1	UTSW	18	12191830	missense	probably damaging	1.00
R0200:Npc1	UTSW	18	12219204	missense	probably damaging	1.00
R0485:Npc1	UTSW	18	12213446	missense	probably benign	0.00
R0699:Npc1	UTSW	18	12210575	missense	probably benign	0.00
R0730:Npc1	UTSW	18	12219325	missense	probably benign	0.00
R1302:Npc1	UTSW	18	12195085	missense	probably benign	0.00
R1442:Npc1	UTSW	18	12195049	missense	probably benign
R1463:Npc1	UTSW	18	12191830	missense	probably damaging	1.00
R1804:Npc1	UTSW	18	12223088	missense	probably damaging	1.00
R1808:Npc1	UTSW	18	12194092	missense	probably damaging	1.00
R1928:Npc1	UTSW	18	12213378	missense	possibly damaging	0.79
R2112:Npc1	UTSW	18	12213472	missense	possibly damaging	0.49
R2117:Npc1	UTSW	18	12196556	missense	probably damaging	1.00
R2157:Npc1	UTSW	18	12191809	missense	probably damaging	0.98
R2279:Npc1	UTSW	18	12197179	splice site	probably null
R2311:Npc1	UTSW	18	12202183	missense	probably benign
R2446:Npc1	UTSW	18	12214339	missense	probably benign	0.01
R3004:Npc1	UTSW	18	12197254	missense	probably benign	0.03
R4090:Npc1	UTSW	18	12198162	splice site	probably null
R4304:Npc1	UTSW	18	12210527	missense	possibly damaging	0.77
R4308:Npc1	UTSW	18	12210527	missense	possibly damaging	0.77
R4564:Npc1	UTSW	18	12191732	missense	probably damaging	1.00
R4786:Npc1	UTSW	18	12199497	missense	probably benign	0.35
R5243:Npc1	UTSW	18	12198631	intron	probably benign
R5404:Npc1	UTSW	18	12213299	missense	possibly damaging	0.79
R5823:Npc1	UTSW	18	12191789	missense	possibly damaging	0.69
R6080:Npc1	UTSW	18	12219351	missense	probably damaging	1.00
R6215:Npc1	UTSW	18	12236192	small deletion	probably benign
R6301:Npc1	UTSW	18	12197245	missense	probably benign	0.00
R6476:Npc1	UTSW	18	12201694	nonsense	probably null
R7007:Npc1	UTSW	18	12210548	missense	probably benign	0.02
R7020:Npc1	UTSW	18	12198537	missense	probably damaging	1.00
R7048:Npc1	UTSW	18	12204765	splice site	probably null
R7116:Npc1	UTSW	18	12211544	missense	probably damaging	1.00
R7153:Npc1	UTSW	18	12213291	missense	possibly damaging	0.78
R7359:Npc1	UTSW	18	12195180	missense	probably benign	0.05
R7382:Npc1	UTSW	18	12201706	missense	probably damaging	0.99
R7765:Npc1	UTSW	18	12195048	missense	probably benign	0.01
R8047:Npc1	UTSW	18	12213317	missense	probably benign	0.00
R8094:Npc1	UTSW	18	12194240	missense	probably benign
R8161:Npc1	UTSW	18	12195072	missense	possibly damaging	0.77
R8310:Npc1	UTSW	18	12193398	missense	probably damaging	0.98
X0012:Npc1	UTSW	18	12193311	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCAACAGATAGGGGACTAAGACTACCCA -3'
(R):5'- GCATCATGTGTCGCTGGCCT -3'

Sequencing Primer
(F):5'- GGGGACTAAGACTACCCATTTTCTG -3'
(R):5'- GATAGCTACTCCTGACTGGTGC -3'

Posted On

2014-06-10