Incidental Mutation 'R0070:Flt3'
ID201457
Institutional Source Beutler Lab
Gene Symbol Flt3
Ensembl Gene ENSMUSG00000042817
Gene NameFMS-like tyrosine kinase 3
SynonymsFlt-3, CD135, Flk-2, wmfl, Flk2
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0070 (G1)
Quality Score60
Status Validated
Chromosome5
Chromosomal Location147330741-147400489 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 147372726 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049324]
Predicted Effect probably benign
Transcript: ENSMUST00000049324
SMART Domains Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
internal_repeat_1 380 529 8.53e-14 PROSPERO
TyrKc 611 946 1.7e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110549
SMART Domains Protein: ENSMUSP00000106178
Gene: ENSMUSG00000042817

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Flt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Flt3 APN 5 147354876 missense probably damaging 1.00
IGL01083:Flt3 APN 5 147354870 missense probably damaging 1.00
IGL01749:Flt3 APN 5 147358028 missense probably benign 0.02
IGL01765:Flt3 APN 5 147357978 missense probably benign
IGL02109:Flt3 APN 5 147350681 missense probably benign 0.00
IGL02490:Flt3 APN 5 147331296 missense probably damaging 1.00
IGL02631:Flt3 APN 5 147344552 missense probably damaging 1.00
IGL03117:Flt3 APN 5 147356210 missense probably benign
flick UTSW 5 147341238 missense probably damaging 1.00
warmflash UTSW 5 147366918 critical splice donor site probably null
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0320:Flt3 UTSW 5 147369579 splice site probably benign
R0347:Flt3 UTSW 5 147357992 missense probably damaging 1.00
R0512:Flt3 UTSW 5 147341270 nonsense probably null
R0968:Flt3 UTSW 5 147341227 missense possibly damaging 0.46
R1180:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R1266:Flt3 UTSW 5 147356860 missense probably benign 0.00
R1562:Flt3 UTSW 5 147344513 missense probably damaging 1.00
R1803:Flt3 UTSW 5 147367055 nonsense probably null
R2000:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R2021:Flt3 UTSW 5 147369490 missense probably damaging 0.98
R2079:Flt3 UTSW 5 147355083 missense probably damaging 0.97
R2261:Flt3 UTSW 5 147348063 missense probably benign 0.00
R2263:Flt3 UTSW 5 147348063 missense probably benign 0.00
R3087:Flt3 UTSW 5 147348046 missense probably benign 0.15
R3727:Flt3 UTSW 5 147354923 missense probably damaging 0.96
R3939:Flt3 UTSW 5 147356243 missense possibly damaging 0.87
R4469:Flt3 UTSW 5 147375644 splice site silent
R4527:Flt3 UTSW 5 147356353 missense probably benign 0.37
R4592:Flt3 UTSW 5 147354699 missense possibly damaging 0.67
R4655:Flt3 UTSW 5 147349593 missense possibly damaging 0.51
R4686:Flt3 UTSW 5 147377048 missense probably damaging 1.00
R4867:Flt3 UTSW 5 147334440 missense probably damaging 1.00
R4897:Flt3 UTSW 5 147369300 missense probably damaging 1.00
R4941:Flt3 UTSW 5 147356375 critical splice acceptor site probably null
R5254:Flt3 UTSW 5 147375690 missense possibly damaging 0.60
R5325:Flt3 UTSW 5 147375649 missense probably benign 0.00
R5395:Flt3 UTSW 5 147354823 missense probably damaging 1.00
R5445:Flt3 UTSW 5 147355095 nonsense probably null
R5469:Flt3 UTSW 5 147355083 missense possibly damaging 0.63
R5556:Flt3 UTSW 5 147332997 splice site probably null
R5660:Flt3 UTSW 5 147369481 missense possibly damaging 0.79
R5879:Flt3 UTSW 5 147334909 missense probably damaging 1.00
R5885:Flt3 UTSW 5 147349629 missense probably damaging 1.00
R6554:Flt3 UTSW 5 147375735 missense probably damaging 0.99
R6813:Flt3 UTSW 5 147354843 missense probably damaging 0.97
R7451:Flt3 UTSW 5 147349667 missense probably damaging 1.00
R7469:Flt3 UTSW 5 147331274 missense probably benign 0.18
R7537:Flt3 UTSW 5 147334437 missense probably damaging 1.00
R7605:Flt3 UTSW 5 147349576 missense probably benign 0.01
R7651:Flt3 UTSW 5 147354922 missense probably damaging 1.00
R7842:Flt3 UTSW 5 147334453 missense probably damaging 1.00
R8051:Flt3 UTSW 5 147358955 intron probably benign
R8236:Flt3 UTSW 5 147356860 missense probably benign 0.00
R8305:Flt3 UTSW 5 147348054 missense probably damaging 0.96
R8337:Flt3 UTSW 5 147332888 critical splice donor site probably null
X0018:Flt3 UTSW 5 147367066 missense possibly damaging 0.54
Z1088:Flt3 UTSW 5 147349564 critical splice donor site probably null
Z1177:Flt3 UTSW 5 147383401 missense probably benign 0.27
Z31818:Flt3 UTSW 5 147366918 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCTGCCAGGAACGGTGGTC -3'
(R):5'- AGCTCAGCCGCTAAATTCTGCTC -3'

Sequencing Primer
(F):5'- TGGTCACGGTCACTAGGAG -3'
(R):5'- ttgggaggtagaggcagg -3'
Posted On2014-06-10