Incidental Mutation 'R0070:Atp2a1'
List |< first << previous [record 4 of 69] next >> last >|
ID201460
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 038361-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0070 (G1)
Quality Score66
Status Validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126447452 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 892 (E892G)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]
Predicted Effect probably benign
Transcript: ENSMUST00000032974
AA Change: E892G

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: E892G

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106405
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106407
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Predicted Effect unknown
Transcript: ENSMUST00000146973
AA Change: E36G
SMART Domains Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730
AA Change: E36G

DomainStartEndE-ValueType
Pfam:Cation_ATPase_C 6 132 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Meta Mutation Damage Score 0.3153 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1748:Atp2a1 UTSW 7 126459608 missense possibly damaging 0.67
R1799:Atp2a1 UTSW 7 126450142 missense probably benign 0.27
R1808:Atp2a1 UTSW 7 126453401 missense probably damaging 0.97
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R2427:Atp2a1 UTSW 7 126446583 makesense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6093:Atp2a1 UTSW 7 126446921 missense probably damaging 1.00
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
R7206:Atp2a1 UTSW 7 126447972 missense probably benign 0.01
R7354:Atp2a1 UTSW 7 126448856 missense probably damaging 1.00
R7363:Atp2a1 UTSW 7 126462889 missense possibly damaging 0.88
R7501:Atp2a1 UTSW 7 126450172 missense probably benign 0.29
R7560:Atp2a1 UTSW 7 126459656 missense possibly damaging 0.95
R7716:Atp2a1 UTSW 7 126462187 missense possibly damaging 0.86
R7772:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R8039:Atp2a1 UTSW 7 126448805 missense probably damaging 0.99
R8391:Atp2a1 UTSW 7 126448716 missense possibly damaging 0.94
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCATAAAATACCACGCCCTGTGAGC -3'
(R):5'- TTTCCCAGCCTTTGGGACCAAC -3'

Sequencing Primer
(F):5'- TGGACACATGCTCTGCATGG -3'
(R):5'- ACCACAGGCTATGTGGGTG -3'
Posted On2014-06-10