Incidental Mutation 'R0070:Sin3b'
ID201461
Institutional Source Beutler Lab
Gene Symbol Sin3b
Ensembl Gene ENSMUSG00000031622
Gene Nametranscriptional regulator, SIN3B (yeast)
Synonyms2810430C10Rik
MMRRC Submission 038361-MU
Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0070 (G1)
Quality Score37
Status Validated
Chromosome8
Chromosomal Location72723285-72758201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72725582 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 105 (H105Q)
Ref Sequence ENSEMBL: ENSMUSP00000148599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000109950] [ENSMUST00000212095] [ENSMUST00000212096]
Predicted Effect probably damaging
Transcript: ENSMUST00000004494
AA Change: H84Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622
AA Change: H84Q

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109950
AA Change: H84Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105576
Gene: ENSMUSG00000031622
AA Change: H84Q

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 3.4e-20 PFAM
Pfam:PAH 173 227 5.6e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212095
AA Change: H84Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212096
AA Change: H105Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr132 A G 17: 38,130,889 L101P probably damaging Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Sin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Sin3b APN 8 72757000 missense probably benign 0.22
IGL01107:Sin3b APN 8 72731105 missense possibly damaging 0.74
IGL01114:Sin3b APN 8 72744505 missense probably benign 0.06
IGL01603:Sin3b APN 8 72750064 missense probably damaging 1.00
IGL01763:Sin3b APN 8 72746608 missense probably damaging 1.00
IGL02078:Sin3b APN 8 72753580 missense possibly damaging 0.49
IGL02572:Sin3b APN 8 72744481 missense probably benign 0.15
IGL02732:Sin3b APN 8 72733453 missense possibly damaging 0.72
IGL02831:Sin3b APN 8 72744562 missense probably damaging 1.00
IGL03064:Sin3b APN 8 72757058 unclassified probably benign
IGL03107:Sin3b APN 8 72753585 missense probably damaging 0.99
IGL03142:Sin3b APN 8 72744568 missense probably damaging 1.00
3-1:Sin3b UTSW 8 72753209 missense possibly damaging 0.95
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0226:Sin3b UTSW 8 72744508 missense probably benign 0.44
R0629:Sin3b UTSW 8 72753536 splice site probably benign
R1486:Sin3b UTSW 8 72750513 missense probably benign 0.00
R1524:Sin3b UTSW 8 72753287 missense probably benign 0.05
R1653:Sin3b UTSW 8 72741519 missense probably benign 0.30
R2144:Sin3b UTSW 8 72731265 missense probably damaging 1.00
R2180:Sin3b UTSW 8 72753295 nonsense probably null
R2271:Sin3b UTSW 8 72733419 missense probably benign 0.11
R2353:Sin3b UTSW 8 72724152 critical splice donor site probably null
R3945:Sin3b UTSW 8 72733439 missense possibly damaging 0.88
R4412:Sin3b UTSW 8 72739779 missense probably benign 0.16
R4564:Sin3b UTSW 8 72753581 missense probably damaging 1.00
R4782:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4799:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4863:Sin3b UTSW 8 72744948 missense possibly damaging 0.91
R5011:Sin3b UTSW 8 72744556 missense probably benign 0.39
R5237:Sin3b UTSW 8 72733343 critical splice acceptor site probably null
R5325:Sin3b UTSW 8 72750526 missense probably damaging 1.00
R5725:Sin3b UTSW 8 72725692 critical splice donor site probably null
R5927:Sin3b UTSW 8 72749878 missense probably benign 0.00
R5945:Sin3b UTSW 8 72731165 missense probably damaging 0.97
R6492:Sin3b UTSW 8 72733490 critical splice donor site probably null
R7092:Sin3b UTSW 8 72747870 critical splice donor site probably null
R7106:Sin3b UTSW 8 72724137 missense possibly damaging 0.90
R7258:Sin3b UTSW 8 72750208 missense probably benign 0.00
R7472:Sin3b UTSW 8 72753225 missense probably damaging 1.00
R7475:Sin3b UTSW 8 72749872 missense possibly damaging 0.47
R7491:Sin3b UTSW 8 72746441 missense probably damaging 1.00
R7636:Sin3b UTSW 8 72747734 nonsense probably null
R8063:Sin3b UTSW 8 72725541 missense probably damaging 1.00
R8354:Sin3b UTSW 8 72741480 missense probably benign
R8454:Sin3b UTSW 8 72741480 missense probably benign
X0017:Sin3b UTSW 8 72731165 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTGTGTCCTGTTGAGTCTCAGCC -3'
(R):5'- ACAAATGCCTAGCTGTGCTCCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CTGTGGGTGCGACTCTC -3'
Posted On2014-06-10