Incidental Mutation 'R0070:Olfr132'
ID201470
Institutional Source Beutler Lab
Gene Symbol Olfr132
Ensembl Gene ENSMUSG00000067186
Gene Nameolfactory receptor 132
SynonymsGA_x6K02T2PSCP-2579687-2578746, MOR256-49
MMRRC Submission 038361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0070 (G1)
Quality Score29
Status Validated
Chromosome17
Chromosomal Location38129863-38134526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38130889 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 101 (L101P)
Ref Sequence ENSEMBL: ENSMUSP00000149593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087128] [ENSMUST00000216804]
Predicted Effect probably damaging
Transcript: ENSMUST00000087128
AA Change: L101P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084368
Gene: ENSMUSG00000067186
AA Change: L101P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 25 244 3.1e-6 PFAM
Pfam:7tm_4 31 308 4.6e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.9e-7 PFAM
Pfam:7tm_1 41 290 8.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216804
AA Change: L101P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217361
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 T C 17: 55,802,154 I387T probably damaging Het
Alpi A G 1: 87,101,159 probably benign Het
Ankfn1 A T 11: 89,392,302 L173Q probably damaging Het
Atp2a1 T C 7: 126,447,452 E892G probably benign Het
AU018091 T C 7: 3,158,898 probably null Het
Capn12 T C 7: 28,889,126 probably benign Het
Capn2 C A 1: 182,473,869 probably benign Het
Cd79b A G 11: 106,311,918 probably benign Het
Cdh7 C T 1: 110,098,372 A446V probably benign Het
Ciapin1 T C 8: 94,825,219 N246S possibly damaging Het
Cmip T A 8: 117,426,554 I270N probably damaging Het
Cyp2d40 A G 15: 82,760,774 V225A unknown Het
Dnah9 A G 11: 66,160,040 V142A probably benign Het
Fam126a T C 5: 23,964,999 S451G probably damaging Het
Flt3 A G 5: 147,372,726 probably benign Het
Gm10238 A G 15: 75,237,585 noncoding transcript Het
Gm4787 T A 12: 81,379,066 D106V probably damaging Het
Hipk2 G A 6: 38,818,984 R117* probably null Het
Ifna11 A G 4: 88,820,275 D106G possibly damaging Het
Igkv1-115 G A 6: 68,161,418 V2I probably benign Het
Itga6 T C 2: 71,826,716 probably benign Het
Kcnj6 C A 16: 94,941,197 K5N probably benign Het
Kcnt1 T C 2: 25,892,362 V191A probably benign Het
Lcorl G A 5: 45,733,701 R437C probably damaging Het
Man2a1 G A 17: 64,659,079 probably null Het
Map3k14 T A 11: 103,239,554 probably null Het
Mtch1 T A 17: 29,340,059 probably benign Het
Myo1c A G 11: 75,660,250 N217S probably benign Het
Olfr1362 T C 13: 21,611,261 K236R possibly damaging Het
Orm3 A G 4: 63,356,646 T64A probably benign Het
Phf20l1 T G 15: 66,639,991 W940G probably damaging Het
Phldb1 C T 9: 44,707,904 R844H probably damaging Het
Piezo2 T C 18: 63,102,084 D814G probably damaging Het
Pkd2 T C 5: 104,466,990 C233R probably damaging Het
Prkd3 A G 17: 78,954,510 Y792H probably damaging Het
Pth1r A T 9: 110,727,550 probably null Het
Pxdn T C 12: 29,982,727 L146S probably damaging Het
Rnf32 A G 5: 29,225,127 T315A probably benign Het
Rpl5 T C 5: 107,901,900 Y12H probably benign Het
Serpinh1 A T 7: 99,349,314 S36R probably damaging Het
Setx A T 2: 29,161,525 T2030S probably benign Het
Sf3a3 G A 4: 124,714,955 V21I probably benign Het
Sin3b T A 8: 72,725,582 H105Q probably damaging Het
Slitrk1 T C 14: 108,913,317 probably benign Het
Slx4 A T 16: 3,988,016 D557E possibly damaging Het
Sprr3 C T 3: 92,457,302 M78I probably benign Het
Ssmem1 A G 6: 30,519,421 E35G possibly damaging Het
Stag1 C T 9: 100,956,408 P1238S probably null Het
Stra6 C T 9: 58,152,615 probably benign Het
Tmem127 T C 2: 127,257,059 V171A probably damaging Het
Tmem150a A G 6: 72,358,759 probably null Het
Top2a C G 11: 99,015,060 probably null Het
Ttn T C 2: 76,814,427 probably null Het
Tusc3 G A 8: 39,063,267 G129R possibly damaging Het
Uspl1 A G 5: 149,209,705 Y422C probably damaging Het
Vmn2r88 A T 14: 51,414,140 T312S probably benign Het
Wdr78 A T 4: 103,059,934 I571K probably damaging Het
Zc3hav1l A T 6: 38,295,190 S215T probably damaging Het
Zfp947 T A 17: 22,146,184 T170S probably benign Het
Other mutations in Olfr132
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02276:Olfr132 APN 17 38130593 missense probably damaging 0.97
IGL02659:Olfr132 APN 17 38130536 missense possibly damaging 0.78
IGL02831:Olfr132 APN 17 38130512 missense probably benign 0.10
R0070:Olfr132 UTSW 17 38130889 missense probably damaging 1.00
R1162:Olfr132 UTSW 17 38131093 missense possibly damaging 0.69
R2697:Olfr132 UTSW 17 38131009 missense probably damaging 0.99
R4694:Olfr132 UTSW 17 38130857 missense probably damaging 1.00
R4883:Olfr132 UTSW 17 38130617 missense probably damaging 1.00
R4933:Olfr132 UTSW 17 38130550 missense probably damaging 1.00
R4982:Olfr132 UTSW 17 38130577 missense probably damaging 0.99
R5058:Olfr132 UTSW 17 38130541 missense probably damaging 1.00
R5653:Olfr132 UTSW 17 38131184 missense possibly damaging 0.63
R5946:Olfr132 UTSW 17 38130707 missense probably benign 0.07
R7083:Olfr132 UTSW 17 38130710 missense probably benign
R7226:Olfr132 UTSW 17 38130433 missense probably benign 0.01
R7391:Olfr132 UTSW 17 38131050 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACTACCCGCTGAGAGCAAAAGG -3'
(R):5'- AATTCTCCCACAGAGCATGGGCAC -3'

Sequencing Primer
(F):5'- CCTGAGGGTAGCAGTAGATTG -3'
(R):5'- GGCACAGTTTGCAATGACAC -3'
Posted On2014-06-10