Incidental Mutation 'R0041:Olfr954'
ID201491
Institutional Source Beutler Lab
Gene Symbol Olfr954
Ensembl Gene ENSMUSG00000094745
Gene Nameolfactory receptor 954
SynonymsGA_x6K02T2PVTD-33158015-33158950, MOR171-53, MOR171-42
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0041 (G1)
Quality Score41
Status Validated
Chromosome9
Chromosomal Location39456701-39464625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39461476 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 12 (F12Y)
Ref Sequence ENSEMBL: ENSMUSP00000151116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080329] [ENSMUST00000214818]
Predicted Effect probably benign
Transcript: ENSMUST00000080329
AA Change: F15Y

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079205
Gene: ENSMUSG00000094745
AA Change: F15Y

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 38 264 3e-5 PFAM
Pfam:7tm_1 44 293 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214818
AA Change: F12Y

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Olfr954
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02704:Olfr954 APN 9 39462283 missense probably damaging 0.98
IGL02793:Olfr954 APN 9 39461506 missense probably benign 0.09
IGL02964:Olfr954 APN 9 39461781 missense possibly damaging 0.88
IGL02979:Olfr954 APN 9 39461523 missense probably benign 0.02
R0153:Olfr954 UTSW 9 39461671 missense probably damaging 0.99
R0269:Olfr954 UTSW 9 39461794 missense probably damaging 1.00
R0426:Olfr954 UTSW 9 39461593 missense probably damaging 1.00
R0731:Olfr954 UTSW 9 39461532 missense probably damaging 1.00
R1800:Olfr954 UTSW 9 39462114 missense probably damaging 1.00
R2340:Olfr954 UTSW 9 39461809 missense probably damaging 1.00
R2901:Olfr954 UTSW 9 39461938 missense probably damaging 0.97
R2912:Olfr954 UTSW 9 39462216 missense probably damaging 1.00
R2939:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R2940:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3081:Olfr954 UTSW 9 39461930 missense probably benign 0.02
R3765:Olfr954 UTSW 9 39461624 nonsense probably null
R4450:Olfr954 UTSW 9 39462032 missense probably benign 0.00
R4515:Olfr954 UTSW 9 39462231 nonsense probably null
R4786:Olfr954 UTSW 9 39461841 missense probably benign 0.16
R4961:Olfr954 UTSW 9 39461887 missense probably damaging 1.00
R5219:Olfr954 UTSW 9 39462267 missense probably benign 0.09
R5602:Olfr954 UTSW 9 39462030 missense probably benign 0.00
R5887:Olfr954 UTSW 9 39461491 missense probably damaging 1.00
R5950:Olfr954 UTSW 9 39462337 missense probably benign 0.01
R6943:Olfr954 UTSW 9 39461863 missense probably benign 0.05
R7567:Olfr954 UTSW 9 39461877 missense possibly damaging 0.92
X0060:Olfr954 UTSW 9 39462274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTTTCACTCGCTAATACAGAC -3'
(R):5'- AGCATTTTAGGGGTAACAACTGTGGAC -3'

Sequencing Primer
(F):5'- TTGAGACTTTGCAATGAAAGGATG -3'
(R):5'- CTGTGGACTGACCAAAGTCAATG -3'
Posted On2014-06-13