Incidental Mutation 'R0041:Ltf'
ID201493
Institutional Source Beutler Lab
Gene Symbol Ltf
Ensembl Gene ENSMUSG00000032496
Gene Namelactotransferrin
SynonymsLf, lactoferrin
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0041 (G1)
Quality Score52
Status Validated
Chromosome9
Chromosomal Location111019271-111042767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111029568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 461 (D461E)
Ref Sequence ENSEMBL: ENSMUSP00000035077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035077] [ENSMUST00000196122] [ENSMUST00000196209] [ENSMUST00000198884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035077
AA Change: D461E

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035077
Gene: ENSMUSG00000032496
AA Change: D461E

DomainStartEndE-ValueType
TR_FER 24 362 1.48e-209 SMART
TR_FER 363 696 4.68e-212 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196122
SMART Domains Protein: ENSMUSP00000143234
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 4 183 6.4e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196209
SMART Domains Protein: ENSMUSP00000143731
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
Pfam:Transferrin 13 78 3.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197893
Predicted Effect probably benign
Transcript: ENSMUST00000198152
Predicted Effect probably benign
Transcript: ENSMUST00000198884
SMART Domains Protein: ENSMUSP00000142432
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 95 4.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199313
Predicted Effect probably benign
Transcript: ENSMUST00000199815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200459
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and grossly normal and exhibit only minor alterations in iron homeostasis. Mice homozygous for a different knock-out allele show increased susceptibility to inflammation-induced colorectal dysplasia along with increased cell proliferation and decreased apoptosis in colonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Ltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ltf APN 9 111022882 intron probably null
IGL01068:Ltf APN 9 111035812 unclassified probably null
IGL01311:Ltf APN 9 111031012 unclassified probably benign
IGL01629:Ltf APN 9 111035806 missense probably damaging 1.00
IGL01765:Ltf APN 9 111022017 missense possibly damaging 0.86
IGL02376:Ltf APN 9 111029624 missense probably benign 0.01
IGL02429:Ltf APN 9 111026125 missense possibly damaging 0.87
IGL02947:Ltf APN 9 111038947 missense probably benign 0.01
IGL03025:Ltf APN 9 111025101 missense possibly damaging 0.93
R0364:Ltf UTSW 9 111025167 missense probably benign 0.19
R0718:Ltf UTSW 9 111040379 missense probably benign 0.01
R1899:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R1900:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R2964:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2965:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2966:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R3051:Ltf UTSW 9 111024522 missense probably benign 0.00
R3122:Ltf UTSW 9 111022900 missense probably damaging 1.00
R4427:Ltf UTSW 9 111023604 missense probably damaging 1.00
R4597:Ltf UTSW 9 111022933 missense probably damaging 1.00
R4604:Ltf UTSW 9 111022341 missense probably damaging 0.99
R4827:Ltf UTSW 9 111027377 unclassified probably benign
R4849:Ltf UTSW 9 111025990 missense probably benign 0.00
R5389:Ltf UTSW 9 111029651 missense possibly damaging 0.50
R5677:Ltf UTSW 9 111020912 start codon destroyed probably null 0.01
R6419:Ltf UTSW 9 111031022 missense possibly damaging 0.67
R6891:Ltf UTSW 9 111025113 missense probably benign 0.13
R7032:Ltf UTSW 9 111026130 critical splice donor site probably null
R7090:Ltf UTSW 9 111025980 missense probably benign 0.00
R7352:Ltf UTSW 9 111028450 missense probably benign
R7857:Ltf UTSW 9 111022376 missense probably benign 0.00
R7940:Ltf UTSW 9 111022376 missense probably benign 0.00
Z1177:Ltf UTSW 9 111021005 missense not run
Z1177:Ltf UTSW 9 111024393 missense not run
Predicted Primers PCR Primer
(F):5'- GGTCTTCCCTTGACACAGAACACC -3'
(R):5'- GTTCCACAGCCTCAAGTACTCACTC -3'

Sequencing Primer
(F):5'- ccttccttccttccttcctttc -3'
(R):5'- TCACTCCCAGACCCAGGATG -3'
Posted On2014-06-13