Incidental Mutation 'R0041:Dtna'
ID 201505
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 038335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R0041 (G1)
Quality Score 53
Status Validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 23779932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000222726]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000115832
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220789
Predicted Effect probably benign
Transcript: ENSMUST00000220904
Predicted Effect probably benign
Transcript: ENSMUST00000222726
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,873,986 (GRCm39) R412G probably damaging Het
Adamts3 T A 5: 89,832,326 (GRCm39) N927Y probably benign Het
Adgra3 A G 5: 50,117,901 (GRCm39) Y1216H probably benign Het
Agpat3 C A 10: 78,123,881 (GRCm39) probably benign Het
AI182371 T A 2: 34,975,733 (GRCm39) Q277L possibly damaging Het
Arhgef15 A T 11: 68,845,342 (GRCm39) L170Q possibly damaging Het
Avpi1 C A 19: 42,112,223 (GRCm39) E112* probably null Het
Braf C T 6: 39,617,413 (GRCm39) A534T probably damaging Het
Bspry G C 4: 62,404,791 (GRCm39) A196P probably damaging Het
Cacna1c T A 6: 118,570,988 (GRCm39) L2095F probably damaging Het
Cdhr2 A T 13: 54,874,651 (GRCm39) S908C probably damaging Het
Cntnap5c C A 17: 58,183,464 (GRCm39) Q57K probably benign Het
Dynap A G 18: 70,375,105 (GRCm39) S37P possibly damaging Het
Efna5 A T 17: 62,914,467 (GRCm39) probably benign Het
Fancm T A 12: 65,153,217 (GRCm39) C1224* probably null Het
Fbxw16 T A 9: 109,277,232 (GRCm39) S37C probably damaging Het
Galnt4 A G 10: 98,944,374 (GRCm39) Y33C probably benign Het
Kcnk2 G T 1: 189,027,888 (GRCm39) N122K probably benign Het
Krt71 C A 15: 101,647,753 (GRCm39) E222D probably damaging Het
Ltf T A 9: 110,858,636 (GRCm39) D461E possibly damaging Het
Mapk4 A T 18: 74,068,109 (GRCm39) L274Q probably damaging Het
Mbd6 A G 10: 127,122,741 (GRCm39) C103R probably damaging Het
Nbeal1 A G 1: 60,321,030 (GRCm39) N2047S probably benign Het
Nefh C T 11: 4,895,184 (GRCm39) S335N possibly damaging Het
Obscn G T 11: 58,934,803 (GRCm39) H4715N probably damaging Het
Olfml1 A T 7: 107,189,393 (GRCm39) I153L possibly damaging Het
Or6d13 G A 6: 116,518,295 (GRCm39) V294I possibly damaging Het
Or8g34 T A 9: 39,372,772 (GRCm39) F12Y probably benign Het
Pck1 A G 2: 172,997,003 (GRCm39) E215G probably benign Het
Peg12 T A 7: 62,113,308 (GRCm39) E263V unknown Het
Phkg1 T A 5: 129,903,103 (GRCm39) T15S probably benign Het
Plekhg1 T A 10: 3,914,076 (GRCm39) L1120* probably null Het
Prss59 A T 6: 40,903,042 (GRCm39) L110* probably null Het
Rlf T A 4: 121,007,126 (GRCm39) H618L probably damaging Het
Rnf112 T A 11: 61,343,181 (GRCm39) R165W probably damaging Het
Rnf213 A G 11: 119,293,401 (GRCm39) T51A probably benign Het
Rnf220 A G 4: 117,130,481 (GRCm39) L293P probably damaging Het
Rock1 T C 18: 10,140,240 (GRCm39) D117G probably damaging Het
Rp1 A G 1: 4,414,851 (GRCm39) V2087A probably benign Het
Rpl7a A G 2: 26,801,563 (GRCm39) probably null Het
Serpinb6d A G 13: 33,851,615 (GRCm39) D124G probably damaging Het
Skor1 T G 9: 63,053,133 (GRCm39) T279P probably damaging Het
Son A T 16: 91,456,221 (GRCm39) E1656V probably damaging Het
Swap70 A G 7: 109,878,562 (GRCm39) K511E probably benign Het
Treh T C 9: 44,594,910 (GRCm39) V262A probably benign Het
Trpm4 A G 7: 44,954,370 (GRCm39) probably null Het
Ugt8a T C 3: 125,708,739 (GRCm39) I124V probably benign Het
Wdr53 T C 16: 32,075,473 (GRCm39) V226A probably damaging Het
Wdr64 G A 1: 175,554,037 (GRCm39) W189* probably null Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGGGCTAATGATCCCTCTTGGAGAC -3'
(R):5'- TTGCAGCTCCACCGTGAATGTACC -3'

Sequencing Primer
(F):5'- agccagataagtcttctgatcc -3'
(R):5'- ACCGTGAATGTACCCAGGTTTC -3'
Posted On 2014-06-13