Incidental Mutation 'R0041:Avpi1'
ID201507
Institutional Source Beutler Lab
Gene Symbol Avpi1
Ensembl Gene ENSMUSG00000018821
Gene Namearginine vasopressin-induced 1
Synonyms2310008N12Rik, mVIT32
MMRRC Submission 038335-MU
Accession Numbers

Genbank: NM_027106; MGI: 1916784

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0041 (G1)
Quality Score50
Status Validated
Chromosome19
Chromosomal Location42123273-42129059 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 42123784 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 112 (E112*)
Ref Sequence ENSEMBL: ENSMUSP00000018965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018965] [ENSMUST00000066778] [ENSMUST00000161873]
Predicted Effect probably null
Transcript: ENSMUST00000018965
AA Change: E112*
SMART Domains Protein: ENSMUSP00000018965
Gene: ENSMUSG00000018821
AA Change: E112*

DomainStartEndE-ValueType
Pfam:TC1 1 76 2.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066778
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161873
SMART Domains Protein: ENSMUSP00000124617
Gene: ENSMUSG00000018821

DomainStartEndE-ValueType
Pfam:TC1 1 76 6.6e-34 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(74) : Targeted(3) Gene trapped(71)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Avpi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Avpi1 UTSW 19 42123784 nonsense probably null
R1713:Avpi1 UTSW 19 42124809 missense probably damaging 1.00
R4031:Avpi1 UTSW 19 42124741 unclassified probably benign
R5547:Avpi1 UTSW 19 42124943 missense probably damaging 1.00
R6675:Avpi1 UTSW 19 42123744 missense probably benign
R7033:Avpi1 UTSW 19 42124977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATGCTGGCTCTGAGCTGAAC -3'
(R):5'- AGAGACTTGTTGAGTGTCCCACCC -3'

Sequencing Primer
(F):5'- TGAGCTGAACTCAGGGCATTC -3'
(R):5'- CCTCTTAACGTTCAGTTTTGGAAAGG -3'
Posted On2014-06-13